SEARCH · Engineering Papers

Results for “Gene expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records

All sources NASA NTRS DOE OSTI

DOE OSTI2021

Nonadditive gene expression is correlated with nonadditive phenotypic expression in interspecific triploid hybrids of willow ( Salix spp.)

Many studies have highlighted the complex and diverse basis for heterosis in inbred crops. Despite the lack of a consensus model, it is vital that we turn our attention to understanding heterosis in undomesticated, heterozygous, and polyploid species, such as willow (Salix spp.). Shrub willow is a dedicated energy crop bred to be fast-growing and high yielding on marginal land without competing with food crops. A trend in willow breeding is the consistent pattern of heterosis in triploids produced from crosses between diploid and tetraploid species. Here, we test whether differentially expressed genes are associated with heterosis in triploid families derived from diploid Salix purpurea, diploid Salix viminalis, and tetraploid Salix miyabeana parents. Three biological replicates of shoot tips from all family progeny and parents were collected after 12 weeks in the greenhouse and RNA extracted for RNA-Seq analysis. This study provides evidence that nonadditive patterns of gene expression are correlated with nonadditive phenotypic expression in interspecific triploid hybrids of willow. Expression-level dominance was most correlated with heterosis for biomass yield traits and was highly enriched for processes involved in starch and sucrose metabolism. In addition, there was a global dosage effect of parent alleles in triploid hybrids, with expression proportional to copy number variation. Importantly, differentially expressed genes between family parents were most predictive of heterosis for both field and greenhouse collected traits. Altogether, these data will be used to progress models of heterosis to complement the growing genomic resources available for the improvement of heterozygous perennial bioenergy crops.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

A transcriptome software comparison for the analyses of treatments expected to give subtle gene expression responses

Background: In this comparative study we evaluate the performance of four software tools: DNAstar-D (DESeq2), DNAstar-E (edgeR), CLC Genomics and Partek Flow for identification of differentially expressed genes (DEGs) using a transcriptome of E. coli. The RNA-seq data are from the effect of below-background radiation 5.5 nGy total dose (0.2nGy/hr) on E. coli grown shielded from natural radiation 655 m below ground in a pre-World War II steel vault. The gene expression response to three supplemented sources of radiation designed to mimic natural background, 1952 – 5720 nGy in total dose (71–208 nGy/hr), are compared to this “radiation-deprived” treatment. In addition, RNA-seq data of Caenorhabditis elegans nematode from similar radiation treatments was analyzed by three of the software packages. Results: In E. coli, the four software programs identified one of the supplementary sources of radiation (KCl) to evoke about 5 times more transcribed genes than the minus-radiation treatment (69–114 differentially expressed genes, DEGs), and so the rest of the analyses used this KCl vs “Minus” comparison. After imposing a 30-read minimum cutoff, one of the DNAStar options shared two of the three steps (mapping, normalization, and statistic) with Partek Flow (they both used median of ratios to normalize and the DESeq2 statistical package), and these two programs identified the highest number of DEGs in common with each other (53). In contrast, when the programs used different approaches in each of the three steps, between 31 and 40 DEGs were found in common. Regarding the extent of expression differences, three of the four programs gave high fold-change results (15–178 fold), but one (DNAstar’s DESeq2) resulted in more conservative fold-changes (1.5–3.5). In a parallel study comparing three qPCR commercial validation software programs, these programs also gave variable results as to which genes were significantly regulated. Similarly, the C. elegans analysis showed exaggerated fold-changes in CLC and DNAstar’s edgeR while DNAstar-D was more conservative. Conclusions: Regarding the extent of expression (fold-change), and considering the subtlety of the very low level radiation treatments, in E. coli three of the four programs gave what we consider exaggerated fold-change results (15 – 178 fold), but one (DNAstar’s DESeq2) gave more realistic fold-changes (1.5–3.5). When RT-qPCR validation comparisons to transcriptome results were carried out, they supported the more conservative DNAstar-D’s expression results. When another model organism’s (nematode) response to these radiation differences was similarly analyzed, DNAstar-D also resulted in the most conservative expression patterns. Therefore, we would propose DESeq2 (“DNAstar-D”) as an appropriate software tool for differential gene expression studies for treatments expected to give subtle transcriptome responses.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2025

Changes in leaf economic trait relationships across a precipitation gradient are related to differential gene expression in a C 4 perennial grass

Summary The leaf economics spectrum (LES) describes a suite of functional traits that consistently covary at large spatial and taxonomic scales. Despite its importance at these larger scales, few studies have examined the major drivers of intraspecific variation in the LES – phenotypic plasticity and standing genetic variation. Using experimental precipitation manipulations, we examined whether covariation among leaf economics traits and selection on leaf economics traits and trait combinations change as diverse genotypes of the widespread perennial grass Panicum virgatum are exposed to differences in precipitation. We also used RNA‐Seq to examine whether groups of co‐expressed genes that align with leaf economics traits function in processes hypothesized to underlie the LES. Water availability impacted leaf economics trait covariation in important ways – covariation between leaf economics traits and selection on covariation between traits (i.e. correlational selection) tended to be strongest when water availability was high. Additionally, many genes associated with leaf economics traits functioned in processes that may explain how the LES originates, such as chloroplasts, cell walls, and nitrogen metabolism. Water availability is likely an important modulator of selection and evolution of the LES in P. virgatum that can be better understood by examining gene expression.

Heckman, Robert W. [Department of Integrative Biol↗

DOE OSTI2024

The quantitative genetics of gene expression in Mimulus guttatus

Gene expression can be influenced by genetic variants that are closely linked to the expressed gene (cis eQTLs) and variants in other parts of the genome (trans eQTLs). We created a multiparental mapping population by sampling genotypes from a single natural population of Mimulus guttatus and scored gene expression in the leaves of 1,588 plants. We find that nearly every measured gene exhibits cis regulatory variation (91% have FDR < 0.05). cis eQTLs are usually allelic series with three or more functionally distinct alleles. The cis locus explains about two thirds of the standing genetic variance (on average) but varies among genes and tends to be greatest when there is high indel variation in the upstream regulatory region and high nucleotide diversity in the coding sequence. Despite mapping over 10,000 trans eQTL / affected gene pairs, most of the genetic variance generated by trans acting loci remains unexplained. This implies a large reservoir of trans acting genes with subtle or diffuse effects. Mapped trans eQTLs show lower allelic diversity but much higher genetic dominance than cis eQTLs. Several analyses also indicate that trans eQTLs make a substantial contribution to the genetic correlations in expression among different genes. They may thus be essential determinants of “gene expression modules,” which has important implications for the evolution of gene expression and how it is studied by geneticists.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2025

Phenotypically anchored transcriptomics across diverse agrichemicals reveals conserved pathways and unique gene expression signatures in zebrafish

Agrichemicals such as herbicides, fungicides, insecticides, and biocides are widely used in agriculture, yet some are associated with adverse effects in humans and the environment. While many of these chemicals have been extensively studied in vitro and are included in the EPA’s ToxCast program, comprehensive in vivo comparisons using RNA sequencing across structurally diverse agrichemicals, in a single screening platform, are lacking. In this study, we examined structurally diverse agrichemicals found in the U.S. Environmental Protection Agency’s (EPA) Toxcast Phase I and II library by statically exposing early life stage zebrafish at 6 h post fertilization (hpf) until 120 hpf at concentrations ranging from 0.25 to 100 µM. Morphological outcomes were assessed at 120 hpf across 10 endpoints, including yolk sac edema, craniofacial malformations, and axis abnormalities. Chemicals that produced robust concentration-response relationships were selected for transcriptomic profiling. For transcriptomic analysis, zebrafish were statically exposed to each chemical and sampled at 48 hpf, prior to the onset of morphological effects observed at 120 hpf. Differential expression analysis identified between 0 and 4,538 differentially expressed genes (DEGs) per chemical, with no clear correlation to morphological severity. Both DEG and co-expression network analyses revealed chemical-specific expression patterns that converged on shared biological pathways, including neurodevelopment and cytoskeletal organization. Key regulatory genes such as mylpfa and krt4 were identified within co-expression modules, suggesting their potential role in conserved toxicity mechanisms. Semantic similarity analysis of enriched gene ontology (GO) terms, when compared to existing datasets, highlighted gaps in the annotation of neurodevelopmental processes, indicating that some in vivo effects may not be fully captured by current curated resources. The results provide new insights into the modes of action of diverse agrichemicals and establish a framework for understanding how agrichemical structure relates to biological function in a vertebrate model.

agrichemical↗

DOE OSTI2022

Concentration-response gene expression analysis in zebrafish reveals phenotypically-anchored transcriptional responses to retene

Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous environmental contaminants and are associated with human disease. Canonically, many PAHs induce toxicity via activation of the aryl hydrocarbon receptor (AHR) pathway. While the interaction between PAHs and the AHR is well-established, understanding which AHR-regulated transcriptional effects directly result in observable phenotypes and which are adaptive or benign is important to better understand PAH toxicity. Retene is a frequently detected PAH in environmental sampling and has been associated with AHR2-dependent developmental toxicity in zebrafish, though its mechanism of toxicity has not been fully elucidated. To interrogate transcriptional changes causally associated with retene toxicity, we conducted whole-animal RNA sequencing at 48 hours post-fertilization after exposure to eight retene concentrations. The concentrations were selected to produce effects ranging from no phenotype to mortality and malformations in 100% of animals at 5 days post-fertilization. We identified a concentration-response relationship between retene teratogenicity and differential gene expression in both number of DEGs and magnitude of expression change. Elevated expression of cyp1a at retene concentrations below the threshold for teratogenicity suggested that while cyp1a expression is a sensitive biomarker of AHR activation, it may be too sensitive to serve as a biomarker of AHR-dependent teratogenicity. Genes differentially expressed at only non-teratogenic concentrations were enriched for transforming growth factor-ß (TGF-ß) signaling pathway disruption while DEGs identified at only teratogenic concentrations were significantly enriched for response to xenobiotic stimulus and reduction-oxidation reaction activity. DEGs which spanned both non-teratogenic and teratogenic concentrations showed similar disrupted biological processes to those unique to teratogenic concentrations, indicating these processes were disrupted at low exposure concentrations. Gene co-expression network analysis identified several gene modules, including those associated with PAHs and AHR2 activation. One, Module 7, was strongly enriched for AHR2-associated genes and contained the strongest responses to retene. Benchmark concentration (BMC) of Module 7 genes identified a median BMC of 7.5 µM, nearly the highest retene concentration with no associated teratogenicity, supporting the hypothesis that Module 7 genes are largely responsible for retene toxicity.

Toxin, Zebrafish, Retene, Transcriptomics, network↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2025

Feed status and skin injury modulate immunopathology, global gene expression, and survival in channel catfish during virulent Aeromonas hydrophila infection

Introduction VirulentAeromonas hydrophilais a major pathogen in channel catfish (Ictalurus punctatus), that causes motileAeromonassepticemia and significant economic losses. We investigated the effect of feeding status and skin integrity on the host immune response, disease survival, and gastrointestinal pathology following a vAh challenge. Methods Using a bath immersion model, channel catfish were divided into four treatment groups: fin clipped and fed (FCF), fin clipped but not fed (FCN), not fin clipped but fed (NCF), and not fin clipped nor fed (NCN) alongside non-challenged control groups The FCF and NCF groups were fed 2 h prior to the challenge, but the FCN and NCN groups were not. Survival analysis, histopathological assessment, and RNA sequencing were conducted across groups at different time intervals throughout the vAh challenge. Results Survival rates were lowest in the FCF and FCN groups (30% and 23% survival, respectively), suggesting that both feeding and skin damage contributed to disease severity. Histopathological analyses revealed more severe intestinal and gastric lesions in fed groups, characterized by epithelial necrosis, hemorrhage, and edema. Transcriptomic analysis among the groups identified significant differentially expressed genes associated with inflammation, apoptosis, and metabolic stress, with notable upregulation of interleukin 1-beta (il-1β), and complement C3 (c3). Gene ontology enrichment highlighted distinct immune activation patterns between fed and unfed groups, with enhanced pathogen recognition and pro-inflammatory responses in unfed fish. Discussion These findings suggest feeding prior to infection may exacerbate disease pathology, potentially by creating a physiological state conducive to facilitate pathogen proliferation and dampened early immune responses, whereas short-term fasting appears to promote early immune activation. This study provides novel insights into the complex interplay between feed status, physical injury, and immune response to vAh infection.

Immunology↗

DOE OSTI2024

Mechanically induced localisation of SECONDARY WALL INTERACTING bZIP is associated with thigmomorphogenic and secondary cell wall gene expression

Plant growth requires the integration of internal and external cues, perceived and transduced into a developmental programme of cell division, elongation and wall thickening. Mechanical forces contribute to this regulation, and thigmomorphogenesis typically includes reducing stem height, increasing stem diameter, and a canonical transcriptomic response. We present data on a bZIP transcription factor involved in this process in grasses. Brachypodium distachyon SECONDARY WALL INTERACTING bZIP (SWIZ) protein translocated into the nucleus following mechanostimulation. Classical touch-responsive genes were upregulated in B. distachyon roots following touch, including significant induction of the glycoside hydrolase 17 family, which may be unique to grass thigmomorphogenesis. SWIZ protein binding to an E-box variant in exons and introns was associated with immediate activation followed by repression of gene expression. SWIZ overexpression resulted in plants with reduced stem and root elongation. These data further define plant touch-responsive transcriptomics and physiology, offering insights into grass mechanotranduction dynamics.

Coomey, Joshua↗

DOE OSTI2026

Data for FUN-PROSE: A Deep Learning Approach to Predict Condition-Specific Gene Expression in Fungi

mRNA levels of all genes in a genome is a critical piece of information defining the overall state of the cell in a given environmental condition. Being able to reconstruct such condition-specific expression in fungal genomes is particularly important to metabolically engineer these organisms to produce desired chemicals in industrially scalable conditions. Most previous deep learning approaches focused on predicting the average expression levels of a gene based on its promoter sequence, ignoring its variation across different conditions. Here we present FUN-PROSE—a deep learning model trained to predict differential expression of individual genes across various conditions using their promoter sequences and expression levels of all transcription factors. We train and test our model on three fungal species and get the correlation between predicted and observed condition-specific gene expression as high as 0.85. We then interpret our model to extract promoter sequence motifs responsible for variable expression of individual genes. We also carried out input feature importance analysis to connect individual transcription factors to their gene targets. A sizeable fraction of both sequence motifs and TF-gene interactions learned by our model agree with previously known biological information, while the rest corresponds to either novel biological facts or indirect correlations.

Genomics↗

DOE OSTI2025

Sorghum bicolor BTx623 Nitrogen Grown Conditions Gene Expression Profiling

Dhurrin, a cyanogenic glucoside, plays an important role in Sorghum bicolor physiology and defense. The concentration of dhurrin in sorghum is influenced by both nitrogen status and stage of plant organ development. While nitrogen resupply activates the expression of genes for dhurrin biosynthesis, the molecular mechanisms underlying this regulation remain unclear. In this study, we investigated the transcriptional response of sorghum to nitrogen resupply following growth under nitrogen-limiting conditions. Using a time-course design, we measured hydrogen cyanide potential (HCNp), growth, and nitrate content at 0-, 2-, 6-, 12-, 24-, 36-, 48-, and 60-h after resupply and collected tissue for RNAseq analysis in parallel for analysis of gene expression and construction of gene regulatory networks (GRNs). HCNp (mg g−1 DW) increased significantly in leaf and stem tissues following nitrogen resupply, with increases in the leaf partially driven by continued declines in controls under ongoing nitrogen stress. Expression of the dhurrin pathway genes was upregulated in leaves from 24 h after nitrogen resupply, with diel expression patterns observable over the remaining time points. No upregulation was observed in roots or stems, suggesting that developmental context overrides environmental cues. GRN analysis identified candidate transcription factors regulating dhurrin biosynthesis genes, including members of the MYB, bZIP, and GARP-type transcription factor families. Some of these candidate transcription factors may be involved in relieving senescence-associated suppression of dhurrin biosynthesis and link nitrogen signaling to pathway activation. These findings provide new insight into the nitrogen-responsive regulation of dhurrin in sorghum, highlighting candidate regulators for future functional characterization.

cyanogenic glucoside↗

DOE OSTI2024

Sorghum bicolor BTx623 Nitrogen Grown Conditions Set2 Gene Expression Profiling

cyanogenic glucoside↗

DOE OSTI2023

Influence of Mild Chronic Stress and Social Isolation on Acute Ozone-Induced Alterations in Stress Biomarkers and Brain-Region-Specific Gene Expression in Male Wistar–Kyoto Rats

Individuals with psychosocial stress often experience an exaggerated response to air pollutants. Ozone (O 3 ) exposure has been associated with the activation of the neuroendocrine stress-response system. We hypothesized that preexistent mild chronic stress plus social isolation (CS), or social isolation (SI) alone, would exacerbate the acute effects of O 3 exposure on the circulating adrenal-derived stress hormones, and the expression of the genes regulating glucocorticoid stress signaling via an altered stress adaptation in a brain-region-specific manner. Male Wistar–Kyoto rats (5 weeks old) were socially isolated, plus were subjected to either CS (noise, confinement, fear, uncomfortable living, hectic activity, and single housing), SI (single housing only, restricted handling and no enrichment) or no stress (NS; double housing, frequent handling and enrichment provided) for 8 weeks. The rats were then exposed to either air or O 3 (0.8 ppm for 4 h), and the samples were collected immediately after. The indicators of sympathetic and hypothalamic–pituitary axis (HPA) activation (i.e., epinephrine, corticosterone, and lymphopenia) increased with O 3 exposure, but there were no effects from CS or SI, except for the depletion of serum BDNF. CS and SI revealed small changes in brain-region-specific glucocorticoid-signaling-associated markers of gene expression in the air-exposed rats (hypothalamic Nr3c1, Nr3c2 Hsp90aa1, Hspa4 and Cnr1 inhibition in SI; hippocampal HSP90aa1 increase in SI; and inhibition of the bed nucleus of the stria terminalis (BNST) Cnr1 in CS). Gene expression across all brain regions was altered by O 3 , reflective of glucocorticoid signaling effects, such as Fkbp5 in NS, CS and SI. The SI effects on Fkbp5 were greatest for SI in BNST. O 3 increased Cnr2 expression in the hypothalamus and olfactory bulbs of the NS and SI groups. O 3 , in all stress conditions, generally inhibited the expression of Nr3c1 in all brain regions, Nr3c2 in the hippocampus and hypothalamus and Bdnf in the hippocampus. SI, in general, showed slightly greater O 3 -induced changes when compared to NS and CS. Serum metabolomics revealed increased sphingomyelins in the air-exposed SI and O 3 -exposed NS, with underlying SI dampening some of the O 3 -induced changes. These results suggest a potential link between preexistent SI and acute O 3 -induced increases in the circulating adrenal-derived stress hormones and brain-region-specific gene expression changes in glucocorticoid signaling, which may partly underlie the stress dynamic in those with long-term SI.

gene expression↗

DOE OSTI2024

Tools for genetic engineering and gene expression control in Novosphingobium aromaticivorans and Rhodobacter sphaeroides

ABSTRACT Alphaproteobacteria have a variety of cellular and metabolic features that provide important insights into biological systems and enable biotechnologies. For example, some species are capable of converting plant biomass into valuable biofuels and bioproducts that have the potential to contribute to the sustainable bioeconomy. Among the Alphaproteobacteria, Novosphingobium aromaticivorans , Rhodobacter sphaeroides , and Zymomonas mobilis show promise as organisms that can be engineered to convert extracted plant lignin or sugars into bioproducts and biofuels. Genetic manipulation of these bacteria is needed to introduce engineered pathways and modulate expression of native genes with the goal of enhancing bioproduct output. Although recent work has expanded the genetic toolkit for Z. mobilis , N. aromaticivorans and R. sphaeroides still need facile, reliable approaches to deliver genetic payloads to the genome and to control gene expression. Here, we expand the platform of genetic tools for N. aromaticivorans and R. sphaeroides to address these issues. We demonstrate that Tn 7 transposition is an effective approach for introducing engineered DNA into the chromosome of N. aromaticivorans and R. sphaeroides . We screen a synthetic promoter library to identify isopropyl β-D-1-thiogalactopyranoside-inducible promoters with regulated activity in both organisms (up to ~15-fold induction in N. aromaticivorans and ~5-fold induction in R. sphaeroides ). Combining Tn 7 integration with promoters from our library, we establish CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) interference systems for N. aromaticivorans and R. sphaeroides (up to ~10-fold knockdown in N. aromaticivorans and R. sphaeroides ) that can target essential genes and modulate engineered pathways. We anticipate that these systems will greatly facilitate both genetic engineering and gene function discovery efforts in these species and other Alphaproteobacteria. IMPORTANCE It is important to increase our understanding of the microbial world to improve health, agriculture, the environment, and biotechnology. For example, building a sustainable bioeconomy depends on the efficient conversion of plant material to valuable biofuels and bioproducts by microbes. One limitation in this conversion process is that microbes with otherwise promising properties for conversion are challenging to genetically engineer. Here we report genetic tools for Novosphingobium aromaticivorans and Rhodobacter sphaeroides that add to the burgeoning set of tools available for genome engineering and gene expression in Alphaproteobacteria. Our approaches allow straightforward insertion of engineered pathways into the N. aromaticivorans or R. sphaeroides genome and control of gene expression by inducing genes with synthetic promoters or repressing genes using CRISPR interference. These tools can be used in future work to gain additional insight into these and other Alphaproteobacteria and to aid in optimizing yield of biofuels and bioproducts.

Hall, Ashley N.↗

DOE OSTI2024

Population‐level gene expression can repeatedly link genes to functions in maize

SUMMARY Transcriptome‐wide association studies (TWAS) can provide single gene resolution for candidate genes in plants, complementing genome‐wide association studies (GWAS) but efforts in plants have been met with, at best, mixed success. We generated expression data from 693 maize genotypes, measured in a common field experiment, sampled over a 2‐h period to minimize diurnal and environmental effects, using full‐length RNA‐seq to maximize the accurate estimation of transcript abundance. TWAS could identify roughly 10 times as many genes likely to play a role in flowering time regulation as GWAS conducted data from the same experiment. TWAS using mature leaf tissue identified known true‐positive flowering time genes known to act in the shoot apical meristem, and trait data from a new environment enabled the identification of additional flowering time genes without the need for new expression data. eQTL analysis of TWAS‐tagged genes identified at least one additional known maize flowering time gene through trans ‐eQTL interactions. Collectively these results suggest the gene expression resource described here can link genes to functions across different plant phenotypes expressed in a range of tissues and scored in different experiments.

Torres‐Rodríguez, J. Vladimir↗

DOE OSTI2022

Evaluating the performance of random forest and iterative random forest based methods when applied to gene expression data

Gene-to-gene networks, such as Gene Regulatory Networks (GRN) and Predictive Expression Networks (PEN) capture relationships between genes and are beneficial for use in downstream biological analyses. There exists multiple network inference tools to produce these gene-to-gene networks from matrices of gene expression data. Random Forest-Leave One Out Prediction (RF-LOOP) is a method that has been shown to be efficient at producing these gene-to-gene networks, frequently known as GEne Network Inference with Ensemble of trees (GENIE3). Random Forest can be replaced in this process by iterative Random Forest (iRF), which performs variable selection and boosting. Here we validate that iterative Random Forest-Leave One Out Prediction (iRF-LOOP) produces higher quality networks than GENIE3 (RF-LOOP). We use both synthetic and empirical networks from the Dialogue for Reverse Engineering Assessment and Methods (DREAM) Challenges by Sage Bionetworks, as well as two additional empirical networks created from Arabidopsis thaliana and Populus trichocarpa expression data.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

Evaluating the Performance of Random Forest and Iterative Random Forest Based Methods when Applied to Gene Expression Data

Gene-to-gene networks, such as Gene Regulatory Networks (GRN) and Predictive Expression Networks (PEN) capture relationships between genes and are beneficial for use in downstream biological analyses. There exists multiple network inference tools to produce these gene-to-gene networks from matrices of gene expression data. Random Forest-Leave One Out Prediction (RF-LOOP) is a method that has been shown to be efficient at producing these gene-to-gene networks, frequently known as GEne Network Inference with Ensemble of trees (GENIE3). Here we validate that iterative Random Forest-Leave One Out Prediction (iRF-LOOP) produces higher quality networks than GENIE3. We use both synthetic and empirical networks from the Dialogue for Reverse Engineering Assessment and Methods (DREAM) Challenges by Sage Bionetworks, as well as two additional empirical networks created from Arabidopsis thaliana and Populus trichocarpa expression data.

iRF-Loop, expression network, Populus Trichocarpa↗

DOE OSTI2021

Regulation of dhurrin pathway gene expression during Sorghum bicolor development

Plant defence models evaluate the costs and benefits of resource investments at different stages in the life cycle. Poor understanding of the molecular regulation of defence deployment and remobilization hampers accuracy of the predictions. Cyanogenic glucosides, such as dhurrin are phytoanticipins that release hydrogen cyanide upon bio-activation. In this study, RNA-seq was used to investigate the expression of genes involved in the biosynthesis, bio-activation and recycling of dhurrin in Sorghum bicolor . Genes involved in dhurrin biosynthesis were highly expressed in all young developing vegetative tissues (leaves, leaf sheath, roots, stems), tiller buds and imbibing seeds and showed gene specific peaks of expression in leaves during diel cycles. Genes involved in dhurrin bio-activation were expressed early in organ development with organ-specific expression patterns. Genes involved in recycling were expressed at similar levels in the different organ during development, although post-floral initiation when nutrients are remobilized for grain filling, expression of GSTL1 decreased > tenfold in leaves and NITB2 increased > tenfold in stems. Results are consistent with the establishment of a pre-emptive defence in young tissues and regulated recycling related to organ senescence and increased demand for nitrogen during grain filling. This detailed characterization of the transcriptional regulation of dhurrin biosynthesis, bioactivation and remobilization genes during organ and plant development will aid elucidation of gene regulatory networks and signalling pathways that modulate gene expression and dhurrin levels. In-depth knowledge of dhurrin metabolism could improve the yield, nitrogen use efficiency and stress resilience of Sorghum .

59 BASIC BIOLOGICAL SCIENCES↗