SEARCH · Engineering Papers

Results for “Gene expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records

All sources NASA NTRS DOE OSTI

DOE OSTI2021

Nonadditive gene expression is correlated with nonadditive phenotypic expression in interspecific triploid hybrids of willow ( Salix spp.)

Many studies have highlighted the complex and diverse basis for heterosis in inbred crops. Despite the lack of a consensus model, it is vital that we turn our attention to understanding heterosis in undomesticated, heterozygous, and polyploid species, such as willow (Salix spp.). Shrub willow is a dedicated energy crop bred to be fast-growing and high yielding on marginal land without competing with food crops. A trend in willow breeding is the consistent pattern of heterosis in triploids produced from crosses between diploid and tetraploid species. Here, we test whether differentially expressed genes are associated with heterosis in triploid families derived from diploid Salix purpurea, diploid Salix viminalis, and tetraploid Salix miyabeana parents. Three biological replicates of shoot tips from all family progeny and parents were collected after 12 weeks in the greenhouse and RNA extracted for RNA-Seq analysis. This study provides evidence that nonadditive patterns of gene expression are correlated with nonadditive phenotypic expression in interspecific triploid hybrids of willow. Expression-level dominance was most correlated with heterosis for biomass yield traits and was highly enriched for processes involved in starch and sucrose metabolism. In addition, there was a global dosage effect of parent alleles in triploid hybrids, with expression proportional to copy number variation. Importantly, differentially expressed genes between family parents were most predictive of heterosis for both field and greenhouse collected traits. Altogether, these data will be used to progress models of heterosis to complement the growing genomic resources available for the improvement of heterozygous perennial bioenergy crops.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

A transcriptome software comparison for the analyses of treatments expected to give subtle gene expression responses

Background: In this comparative study we evaluate the performance of four software tools: DNAstar-D (DESeq2), DNAstar-E (edgeR), CLC Genomics and Partek Flow for identification of differentially expressed genes (DEGs) using a transcriptome of E. coli. The RNA-seq data are from the effect of below-background radiation 5.5 nGy total dose (0.2nGy/hr) on E. coli grown shielded from natural radiation 655 m below ground in a pre-World War II steel vault. The gene expression response to three supplemented sources of radiation designed to mimic natural background, 1952 – 5720 nGy in total dose (71–208 nGy/hr), are compared to this “radiation-deprived” treatment. In addition, RNA-seq data of Caenorhabditis elegans nematode from similar radiation treatments was analyzed by three of the software packages. Results: In E. coli, the four software programs identified one of the supplementary sources of radiation (KCl) to evoke about 5 times more transcribed genes than the minus-radiation treatment (69–114 differentially expressed genes, DEGs), and so the rest of the analyses used this KCl vs “Minus” comparison. After imposing a 30-read minimum cutoff, one of the DNAStar options shared two of the three steps (mapping, normalization, and statistic) with Partek Flow (they both used median of ratios to normalize and the DESeq2 statistical package), and these two programs identified the highest number of DEGs in common with each other (53). In contrast, when the programs used different approaches in each of the three steps, between 31 and 40 DEGs were found in common. Regarding the extent of expression differences, three of the four programs gave high fold-change results (15–178 fold), but one (DNAstar’s DESeq2) resulted in more conservative fold-changes (1.5–3.5). In a parallel study comparing three qPCR commercial validation software programs, these programs also gave variable results as to which genes were significantly regulated. Similarly, the C. elegans analysis showed exaggerated fold-changes in CLC and DNAstar’s edgeR while DNAstar-D was more conservative. Conclusions: Regarding the extent of expression (fold-change), and considering the subtlety of the very low level radiation treatments, in E. coli three of the four programs gave what we consider exaggerated fold-change results (15 – 178 fold), but one (DNAstar’s DESeq2) gave more realistic fold-changes (1.5–3.5). When RT-qPCR validation comparisons to transcriptome results were carried out, they supported the more conservative DNAstar-D’s expression results. When another model organism’s (nematode) response to these radiation differences was similarly analyzed, DNAstar-D also resulted in the most conservative expression patterns. Therefore, we would propose DESeq2 (“DNAstar-D”) as an appropriate software tool for differential gene expression studies for treatments expected to give subtle transcriptome responses.

59 BASIC BIOLOGICAL SCIENCES↗

NASA NTRSDate not supplied

Gene expression changes in peripheral blood mononuclear cells of ISS crewmembers suggest impacts of spaceflight on cell death

In space, living organisms are exposed to numerous stress factors including microgravity and space radiation. For humans, these harmful environmental factors have been known to cause negative health impacts such as immune dysfunction. Understanding the mechanisms by which spaceflight impacts human health at the molecular level is critical not only for accurately assessing the risks associated with spaceflight, but also for developing effective countermeasures. This study is part of the Functional Immune Project, intended to determine alterations in crewmembers` immunobiology before, during, and after spaceflight. For this project, blood samples were collected from International Space Station (ISS) crewmembers at the following time points: i) at two pre-flight time points of 180 days (L180) and 45 days (L45) before launch. ii) During flight, blood was drawn at approximately the midpoint (mid-flight, MF) of the mission, and shortly before egress from the ISS (late-flight, LF). iii) Post-flight blood samples were collected within 24 hrs (R0), 30 days (R30) and 90 days (R90) after landing. For each crewmember, blood was also drawn from a matching test subject on the ground at the corresponding time point. For both the ISS crewmembers and the ground control subjects, total RNA was isolated from peripheral blood mononuclear cells (PBMC) and mRNA was analysed using next generation RNA-sequencing (NGS). Differentially expressed genes were determined by performing contrast analysis. Using the data from all of the time points from the ground control subjects as a control, a number of dysregulated genes were identified in astronauts at MF, LF and R0, including downregulations of several cell cycle related genes including CDKN1A and VEGFA at MF and LF. Pathway analysis of these differentially expressed genes indicated that, in space, pathways associated with autophagy and senescence were affected. Our analysis also indicated that the genes related to metabolisms were downregulated in the microgravity environment. Taken together, our data suggests that PBMC in the ISS crewmembers may be starved, resulting in autophagy and delayed senescence in space. Such findings are in agreement with delayed cell death in PBMC under simulated microgravity conditions on the ground and offer an explanation for telomere lengthening that has been reported among the ISS astronauts in flight.

Maria Moreno-Villanueva↗

NASA NTRSDate not supplied

Gene Expression Changes in Peripheral Blood Mononuclear Cells of ISS Crewmembers Suggest Impacts of Spaceflight on Cell Death

In space, living organisms are exposed to numerous stress factors including microgravity and space radiation. For humans, these harmful environmental factors have been known to cause negative health impacts such as immune dysfunction. Understanding the mechanisms by which spaceflight impacts human health at the molecular level is critical not only for accurately assessing the risks associated with spaceflight, but also for developing effective countermeasures. This study is part of the Functional Immune Project, intended to determine alterations in crewmembers` immunobiology before, during, and after spaceflight. For this project, blood samples were collected from International Space Station (ISS) crewmembers at the following time points: i) at two pre-flight time points of 180 days (L180) and 45 days (L45) before launch. ii) During flight, blood was drawn at approximately the midpoint (mid-flight, MF) of the mission, and shortly before egress from the ISS (late-flight, LF). iii) Post-flight blood samples were collected within 24 hrs (R0), 30 days (R30) and 90 days (R90) after landing. For each crewmember, blood was also drawn from a matching test subject on the ground at the corresponding time point. For both the ISS crewmembers and the ground control subjects, total RNA was isolated from peripheral blood mononuclear cells (PBMC) and mRNA was analysed using next generation RNA-sequencing (NGS). Differentially expressed genes were determined by performing contrast analysis. Using the data from all of the time points from the ground control subjects as a control, a number of dysregulated genes were identified in astronauts at MF, LF and R0, including downregulations of several cell cycle related genes including CDKN1A and VEGFA at MF and LF. Pathway analysis of these differentially expressed genes indicated that, in space, pathways associated with autophagy and senescence were affected. Our analysis also indicated that the genes related to metabolisms were downregulated in the microgravity environment. Taken together, we hypothesize that PBMC in the ISS crewmembers may be starved, resulting in autophagy and delayed senescence in space. Such findings are in agreement with delayed cell death in PBMC under simulated microgravity conditions on the ground and offer an explanation for telomere lengthening that has been reported among the ISS astronauts in flight

Maria Moreno-Villanueva↗

DOE OSTI2025

Changes in leaf economic trait relationships across a precipitation gradient are related to differential gene expression in a C 4 perennial grass

Summary The leaf economics spectrum (LES) describes a suite of functional traits that consistently covary at large spatial and taxonomic scales. Despite its importance at these larger scales, few studies have examined the major drivers of intraspecific variation in the LES – phenotypic plasticity and standing genetic variation. Using experimental precipitation manipulations, we examined whether covariation among leaf economics traits and selection on leaf economics traits and trait combinations change as diverse genotypes of the widespread perennial grass Panicum virgatum are exposed to differences in precipitation. We also used RNA‐Seq to examine whether groups of co‐expressed genes that align with leaf economics traits function in processes hypothesized to underlie the LES. Water availability impacted leaf economics trait covariation in important ways – covariation between leaf economics traits and selection on covariation between traits (i.e. correlational selection) tended to be strongest when water availability was high. Additionally, many genes associated with leaf economics traits functioned in processes that may explain how the LES originates, such as chloroplasts, cell walls, and nitrogen metabolism. Water availability is likely an important modulator of selection and evolution of the LES in P. virgatum that can be better understood by examining gene expression.

Heckman, Robert W. [Department of Integrative Biol↗

DOE OSTI2024

The quantitative genetics of gene expression in Mimulus guttatus

Gene expression can be influenced by genetic variants that are closely linked to the expressed gene (cis eQTLs) and variants in other parts of the genome (trans eQTLs). We created a multiparental mapping population by sampling genotypes from a single natural population of Mimulus guttatus and scored gene expression in the leaves of 1,588 plants. We find that nearly every measured gene exhibits cis regulatory variation (91% have FDR < 0.05). cis eQTLs are usually allelic series with three or more functionally distinct alleles. The cis locus explains about two thirds of the standing genetic variance (on average) but varies among genes and tends to be greatest when there is high indel variation in the upstream regulatory region and high nucleotide diversity in the coding sequence. Despite mapping over 10,000 trans eQTL / affected gene pairs, most of the genetic variance generated by trans acting loci remains unexplained. This implies a large reservoir of trans acting genes with subtle or diffuse effects. Mapped trans eQTLs show lower allelic diversity but much higher genetic dominance than cis eQTLs. Several analyses also indicate that trans eQTLs make a substantial contribution to the genetic correlations in expression among different genes. They may thus be essential determinants of “gene expression modules,” which has important implications for the evolution of gene expression and how it is studied by geneticists.

59 BASIC BIOLOGICAL SCIENCES↗

NASA NTRS2012

Gene Expression Measurement Module (GEMM) - A Fully Automated, Miniaturized Instrument for Measuring Gene Expression in Space

The capability to measure gene expression on board spacecraft opens the door to a large number of high-value experiments on the influence of the space environment on biological systems. For example, measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, and determine the metabolic bases of microbial pathogenicity and drug resistance. These and other applications hold significant potential for discoveries in space biology, biotechnology, and medicine. Supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measurement of expression of several hundreds of microbial genes from multiple samples. The instrument will be capable of (1) lysing cell walls of bacteria sampled from cultures grown in space, (2) extracting and purifying RNA released from cells, (3) hybridizing the RNA on a microarray and (4) providing readout of the microarray signal, all in a single microfluidics cartridge. The device is suitable for deployment on nanosatellite platforms developed by NASA Ames' Small Spacecraft Division. To meet space and other technical constraints imposed by these platforms, a number of technical innovations are being implemented. The integration and end-to-end technological and biological validation of the instrument are carried out using as a model the photosynthetic bacterium Synechococcus elongatus, known for its remarkable metabolic diversity and resilience to adverse conditions. Each step in the measurement process-lysis, nucleic acid extraction, purification, and hybridization to an array-is assessed through comparison of the results obtained using the instrument with those from standard laboratory protocols. Once developed, the system can be used with minor modifications for multiple experiments on different platforms in space, including extension to higher organisms and microbial monitoring. A proposed version of GEMM that is capable of handling both microbial and tissue samples on the International Space Station will be briefly summarized.

Pohorille, Andrew↗

DOE OSTI2025

Phenotypically anchored transcriptomics across diverse agrichemicals reveals conserved pathways and unique gene expression signatures in zebrafish

Agrichemicals such as herbicides, fungicides, insecticides, and biocides are widely used in agriculture, yet some are associated with adverse effects in humans and the environment. While many of these chemicals have been extensively studied in vitro and are included in the EPA’s ToxCast program, comprehensive in vivo comparisons using RNA sequencing across structurally diverse agrichemicals, in a single screening platform, are lacking. In this study, we examined structurally diverse agrichemicals found in the U.S. Environmental Protection Agency’s (EPA) Toxcast Phase I and II library by statically exposing early life stage zebrafish at 6 h post fertilization (hpf) until 120 hpf at concentrations ranging from 0.25 to 100 µM. Morphological outcomes were assessed at 120 hpf across 10 endpoints, including yolk sac edema, craniofacial malformations, and axis abnormalities. Chemicals that produced robust concentration-response relationships were selected for transcriptomic profiling. For transcriptomic analysis, zebrafish were statically exposed to each chemical and sampled at 48 hpf, prior to the onset of morphological effects observed at 120 hpf. Differential expression analysis identified between 0 and 4,538 differentially expressed genes (DEGs) per chemical, with no clear correlation to morphological severity. Both DEG and co-expression network analyses revealed chemical-specific expression patterns that converged on shared biological pathways, including neurodevelopment and cytoskeletal organization. Key regulatory genes such as mylpfa and krt4 were identified within co-expression modules, suggesting their potential role in conserved toxicity mechanisms. Semantic similarity analysis of enriched gene ontology (GO) terms, when compared to existing datasets, highlighted gaps in the annotation of neurodevelopmental processes, indicating that some in vivo effects may not be fully captured by current curated resources. The results provide new insights into the modes of action of diverse agrichemicals and establish a framework for understanding how agrichemical structure relates to biological function in a vertebrate model.

agrichemical↗

DOE OSTI2022

Concentration-response gene expression analysis in zebrafish reveals phenotypically-anchored transcriptional responses to retene

Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous environmental contaminants and are associated with human disease. Canonically, many PAHs induce toxicity via activation of the aryl hydrocarbon receptor (AHR) pathway. While the interaction between PAHs and the AHR is well-established, understanding which AHR-regulated transcriptional effects directly result in observable phenotypes and which are adaptive or benign is important to better understand PAH toxicity. Retene is a frequently detected PAH in environmental sampling and has been associated with AHR2-dependent developmental toxicity in zebrafish, though its mechanism of toxicity has not been fully elucidated. To interrogate transcriptional changes causally associated with retene toxicity, we conducted whole-animal RNA sequencing at 48 hours post-fertilization after exposure to eight retene concentrations. The concentrations were selected to produce effects ranging from no phenotype to mortality and malformations in 100% of animals at 5 days post-fertilization. We identified a concentration-response relationship between retene teratogenicity and differential gene expression in both number of DEGs and magnitude of expression change. Elevated expression of cyp1a at retene concentrations below the threshold for teratogenicity suggested that while cyp1a expression is a sensitive biomarker of AHR activation, it may be too sensitive to serve as a biomarker of AHR-dependent teratogenicity. Genes differentially expressed at only non-teratogenic concentrations were enriched for transforming growth factor-ß (TGF-ß) signaling pathway disruption while DEGs identified at only teratogenic concentrations were significantly enriched for response to xenobiotic stimulus and reduction-oxidation reaction activity. DEGs which spanned both non-teratogenic and teratogenic concentrations showed similar disrupted biological processes to those unique to teratogenic concentrations, indicating these processes were disrupted at low exposure concentrations. Gene co-expression network analysis identified several gene modules, including those associated with PAHs and AHR2 activation. One, Module 7, was strongly enriched for AHR2-associated genes and contained the strongest responses to retene. Benchmark concentration (BMC) of Module 7 genes identified a median BMC of 7.5 µM, nearly the highest retene concentration with no associated teratogenicity, supporting the hypothesis that Module 7 genes are largely responsible for retene toxicity.

Toxin, Zebrafish, Retene, Transcriptomics, network↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2025

Feed status and skin injury modulate immunopathology, global gene expression, and survival in channel catfish during virulent Aeromonas hydrophila infection

Introduction VirulentAeromonas hydrophilais a major pathogen in channel catfish (Ictalurus punctatus), that causes motileAeromonassepticemia and significant economic losses. We investigated the effect of feeding status and skin integrity on the host immune response, disease survival, and gastrointestinal pathology following a vAh challenge. Methods Using a bath immersion model, channel catfish were divided into four treatment groups: fin clipped and fed (FCF), fin clipped but not fed (FCN), not fin clipped but fed (NCF), and not fin clipped nor fed (NCN) alongside non-challenged control groups The FCF and NCF groups were fed 2 h prior to the challenge, but the FCN and NCN groups were not. Survival analysis, histopathological assessment, and RNA sequencing were conducted across groups at different time intervals throughout the vAh challenge. Results Survival rates were lowest in the FCF and FCN groups (30% and 23% survival, respectively), suggesting that both feeding and skin damage contributed to disease severity. Histopathological analyses revealed more severe intestinal and gastric lesions in fed groups, characterized by epithelial necrosis, hemorrhage, and edema. Transcriptomic analysis among the groups identified significant differentially expressed genes associated with inflammation, apoptosis, and metabolic stress, with notable upregulation of interleukin 1-beta (il-1β), and complement C3 (c3). Gene ontology enrichment highlighted distinct immune activation patterns between fed and unfed groups, with enhanced pathogen recognition and pro-inflammatory responses in unfed fish. Discussion These findings suggest feeding prior to infection may exacerbate disease pathology, potentially by creating a physiological state conducive to facilitate pathogen proliferation and dampened early immune responses, whereas short-term fasting appears to promote early immune activation. This study provides novel insights into the complex interplay between feed status, physical injury, and immune response to vAh infection.

Immunology↗

NASA NTRS2014

Chronic Lunar Dust Exposure on Rat Cornea: Evaluation by Gene Expression Profiling

Lunar dust is capable of entering habitats and vehicle compartments by sticking to spacesuits or other objects that are transferred into the spacecraft from the lunar surface and has been reported to cause irritation upon exposure. During the Apollo missions, crewmembers reported irritation specifically to the skin and eyes after contamination of the lunar and service modules. It has since been hypothesized that ocular irritation and abrasion might occur as a result of such exposure, impairing crew vision. Recent work has shown that both ultrafine and unground lunar dust exhibited minimal irritancy of the ocular surface (i.e., cornea); however, the assessment of the severity of ocular damage resulting from contact of lunar dust particles to the cornea has focused only on macroscopic signs of mechanical irritancy and cytotoxicity. Given the chemical reactive properties of lunar dust, exposure of the cornea may contribute to detrimental effects at the molecular level including but not limited to oxidative damage. Additionally, low level chronic exposures may confound any results obtained in previous acute studies. We report here preliminary results from a tissue sharing effort using 10‐week‐old Fischer 344 male rats chronically exposed to filtered air or jet milled lunar dust collected during Apollo 14 using a Jaeger‐NYU nose‐only chamber for a total of 120 hours (6 hours daily, 5 days a week) over a 4‐week period. RNA was isolated from corneas collected from rats at 1 day and 7 days after being exposed to concentrations of 0, 20, and 60 mg/m3 of lunar dust. Microarray analysis was performed using the Affymetrix GeneChip Rat Genome 230 2.0 Array with Affymetrix Expression Console and Transcriptome Analysis Console used for normalization and secondary analysis. An Ingenuity iReport"TM" was then generated for canonical pathway identification. The number of differentially expressed genes identified increases with dose compared to controls suggesting a more severe response to the lunar dust insult at higher levels. Pathways of interests that have been identified in all exposed samples include oxidative stress response, mitochondrial dysfunction, fibrosis, epithelial healing, TGF-Beta signaling, and extracellular matrix remodeling. Several biological processes related to cell migration, cellular proliferation, and eye development were also identified to be altered by exposure to lunar dust. Our preliminary results suggest that even a chronic insult of lunar dust as low as 20 mg/m(exp 3) elicits a molecular response in cornea tissue. Lunar dust on the surface of the moon would have the added properties of ionization and activation potentially leading to further damage to the cornea and greater sensitivity to any other environmental insult such as exposure to radiation. Additional studies are required to fully assess the risk of vision impairment and the mechanistic responses initiated in cornea exposed to lunar dust as well as the potential for long‐term effects to astronaut health

Theriot, C. A.↗

DOE OSTI2024

Mechanically induced localisation of SECONDARY WALL INTERACTING bZIP is associated with thigmomorphogenic and secondary cell wall gene expression

Plant growth requires the integration of internal and external cues, perceived and transduced into a developmental programme of cell division, elongation and wall thickening. Mechanical forces contribute to this regulation, and thigmomorphogenesis typically includes reducing stem height, increasing stem diameter, and a canonical transcriptomic response. We present data on a bZIP transcription factor involved in this process in grasses. Brachypodium distachyon SECONDARY WALL INTERACTING bZIP (SWIZ) protein translocated into the nucleus following mechanostimulation. Classical touch-responsive genes were upregulated in B. distachyon roots following touch, including significant induction of the glycoside hydrolase 17 family, which may be unique to grass thigmomorphogenesis. SWIZ protein binding to an E-box variant in exons and introns was associated with immediate activation followed by repression of gene expression. SWIZ overexpression resulted in plants with reduced stem and root elongation. These data further define plant touch-responsive transcriptomics and physiology, offering insights into grass mechanotranduction dynamics.

Coomey, Joshua↗

DOE OSTI2026

Data for FUN-PROSE: A Deep Learning Approach to Predict Condition-Specific Gene Expression in Fungi

mRNA levels of all genes in a genome is a critical piece of information defining the overall state of the cell in a given environmental condition. Being able to reconstruct such condition-specific expression in fungal genomes is particularly important to metabolically engineer these organisms to produce desired chemicals in industrially scalable conditions. Most previous deep learning approaches focused on predicting the average expression levels of a gene based on its promoter sequence, ignoring its variation across different conditions. Here we present FUN-PROSE—a deep learning model trained to predict differential expression of individual genes across various conditions using their promoter sequences and expression levels of all transcription factors. We train and test our model on three fungal species and get the correlation between predicted and observed condition-specific gene expression as high as 0.85. We then interpret our model to extract promoter sequence motifs responsible for variable expression of individual genes. We also carried out input feature importance analysis to connect individual transcription factors to their gene targets. A sizeable fraction of both sequence motifs and TF-gene interactions learned by our model agree with previously known biological information, while the rest corresponds to either novel biological facts or indirect correlations.

Genomics↗

NASA NTRS2016

Gene Expression and Structural Skeletal Responses to Long-Duration Simulated Microgravity in Rats

Spaceflight has deleterious effects on skeletal structure and function, specifically causingprofound loss in bone mass, density, and strength, as well as changes in expression levels of genes related to oxidative stress [Hyeon et al., Smith et al.]. It is known that bone resorption remains elevated after spaceflight and that bone density and strength fail to recover completely even years following spaceflight [Smith et al., Carpenter et al.]. However, our current understanding of the signaling pathways and molecular mechanisms that control bone loss and that link oxidative stress, bone resorption, and mechanical unloading of skeletal tissue is incomplete. Here, we aim to examine skeletal responses to simulated long-duration spaceflight on bone loss using the ground-based hindlimb unloading (HU) model in adult (9 months old) male rats. We hypothesized that simulated microgravity leads to the temporal regulation of oxidative-defense genes and pro-osteoclastogenic factors, showing progression and eventual plateau during long-term unloading, and that transient changes at early timepoints in these pathways precede skeletal adaptations to long-duration unloading. We will identify oxidativestress and bone resorption-related changes using global gene expression analysis (Affymetrix arrays) for both acute (within 14 days) and long-term timepoints (90 days). We will also use quantitative PCR to examine changes in expression of genes related to oxidative metabolism (e.g. Nrf2, SOD-1), bone turnover (resorption and formation markers, e.g. TRAP, osteocalcin respectively, SOST), and osteoclastogenesis (e.g. RANKL, OPG) at both early and late timepoints. We will then use detailed microarchitectural and structural analysis through microcomputed tomography to relate gene expression changes with structural changes in bone, expecting that plateaus in gene expression correlate with long-term changes in bone microarchitecture.

Rael, Victoria E.↗

DOE OSTI2025

Sorghum bicolor BTx623 Nitrogen Grown Conditions Gene Expression Profiling

Dhurrin, a cyanogenic glucoside, plays an important role in Sorghum bicolor physiology and defense. The concentration of dhurrin in sorghum is influenced by both nitrogen status and stage of plant organ development. While nitrogen resupply activates the expression of genes for dhurrin biosynthesis, the molecular mechanisms underlying this regulation remain unclear. In this study, we investigated the transcriptional response of sorghum to nitrogen resupply following growth under nitrogen-limiting conditions. Using a time-course design, we measured hydrogen cyanide potential (HCNp), growth, and nitrate content at 0-, 2-, 6-, 12-, 24-, 36-, 48-, and 60-h after resupply and collected tissue for RNAseq analysis in parallel for analysis of gene expression and construction of gene regulatory networks (GRNs). HCNp (mg g−1 DW) increased significantly in leaf and stem tissues following nitrogen resupply, with increases in the leaf partially driven by continued declines in controls under ongoing nitrogen stress. Expression of the dhurrin pathway genes was upregulated in leaves from 24 h after nitrogen resupply, with diel expression patterns observable over the remaining time points. No upregulation was observed in roots or stems, suggesting that developmental context overrides environmental cues. GRN analysis identified candidate transcription factors regulating dhurrin biosynthesis genes, including members of the MYB, bZIP, and GARP-type transcription factor families. Some of these candidate transcription factors may be involved in relieving senescence-associated suppression of dhurrin biosynthesis and link nitrogen signaling to pathway activation. These findings provide new insight into the nitrogen-responsive regulation of dhurrin in sorghum, highlighting candidate regulators for future functional characterization.

cyanogenic glucoside↗

DOE OSTI2024

Sorghum bicolor BTx623 Nitrogen Grown Conditions Set2 Gene Expression Profiling

cyanogenic glucoside↗

DOE OSTI2023

Influence of Mild Chronic Stress and Social Isolation on Acute Ozone-Induced Alterations in Stress Biomarkers and Brain-Region-Specific Gene Expression in Male Wistar–Kyoto Rats

Individuals with psychosocial stress often experience an exaggerated response to air pollutants. Ozone (O 3 ) exposure has been associated with the activation of the neuroendocrine stress-response system. We hypothesized that preexistent mild chronic stress plus social isolation (CS), or social isolation (SI) alone, would exacerbate the acute effects of O 3 exposure on the circulating adrenal-derived stress hormones, and the expression of the genes regulating glucocorticoid stress signaling via an altered stress adaptation in a brain-region-specific manner. Male Wistar–Kyoto rats (5 weeks old) were socially isolated, plus were subjected to either CS (noise, confinement, fear, uncomfortable living, hectic activity, and single housing), SI (single housing only, restricted handling and no enrichment) or no stress (NS; double housing, frequent handling and enrichment provided) for 8 weeks. The rats were then exposed to either air or O 3 (0.8 ppm for 4 h), and the samples were collected immediately after. The indicators of sympathetic and hypothalamic–pituitary axis (HPA) activation (i.e., epinephrine, corticosterone, and lymphopenia) increased with O 3 exposure, but there were no effects from CS or SI, except for the depletion of serum BDNF. CS and SI revealed small changes in brain-region-specific glucocorticoid-signaling-associated markers of gene expression in the air-exposed rats (hypothalamic Nr3c1, Nr3c2 Hsp90aa1, Hspa4 and Cnr1 inhibition in SI; hippocampal HSP90aa1 increase in SI; and inhibition of the bed nucleus of the stria terminalis (BNST) Cnr1 in CS). Gene expression across all brain regions was altered by O 3 , reflective of glucocorticoid signaling effects, such as Fkbp5 in NS, CS and SI. The SI effects on Fkbp5 were greatest for SI in BNST. O 3 increased Cnr2 expression in the hypothalamus and olfactory bulbs of the NS and SI groups. O 3 , in all stress conditions, generally inhibited the expression of Nr3c1 in all brain regions, Nr3c2 in the hippocampus and hypothalamus and Bdnf in the hippocampus. SI, in general, showed slightly greater O 3 -induced changes when compared to NS and CS. Serum metabolomics revealed increased sphingomyelins in the air-exposed SI and O 3 -exposed NS, with underlying SI dampening some of the O 3 -induced changes. These results suggest a potential link between preexistent SI and acute O 3 -induced increases in the circulating adrenal-derived stress hormones and brain-region-specific gene expression changes in glucocorticoid signaling, which may partly underlie the stress dynamic in those with long-term SI.

gene expression↗