SEARCH · Engineering Papers
Results for “cells”
Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer
The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as 'TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT'.
Phase wettability and microstructural evolution in solid oxide fuel cell anode materials
Not Available
Bufalin inhibits cell proliferation and migration of hepatocellular carcinoma cells via APOBEC3F induced intestinal immune network for IgA production signaling pathway
This study aimed to evaluate functions of APOBEC3F gene in biological process of hepatocellular carcinoma (HCC) and anti-tumor mechanisms of bufalin.
Extracellular matrix modulates T cell clearance of malignant cells in vitro
Not Available
Electrocatalysis: A direct alcohol fuel cell and surface science perspective
Explore the source record for details and available documents.
Measuring Signaling and RNA-Seq in the Same Cell Links Gene Expression to Dynamic Patterns of NF-κB Activation
Not provided.
Rhamnose-Containing Cell Wall Polymers Suppress Helical Plant Growth Independently of Microtubule Orientation
Not provided.
Elucidating effects of cell architecture, electrode material, and solution composition on overpotentials in redox flow batteries
Explore the source record for details and available documents.
Large elastoplasticity under static megabar pressures: Formulation and application to compression of samples in diamond anvil cells
Explore the source record for details and available documents.
Conjugated Organic Cations Enable Efficient Self-Healing FASnI3 Solar Cells
Not provided.
Effects of flow cell design on charge percolation and storage in the carbon slurry electrodes of electrochemical flow capacitors
Explore the source record for details and available documents.
Performance of Advanced Automotive Fuel Cell Systems with Heat Rejection Constraint
Explore the source record for details and available documents.