SEARCH · Engineering Papers
Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
On page 1852, the first sentence of the second paragraph “In all PAVMs, the mean diameter of the feeding artery was 7.24 ± 0.015 mm, and the mean maximum diameter of the sac was 19.10 ± 0.585 mm” should be corrected to read as follows:.
The corresponding author would like to indicate his correction to his affiliation.
The original article requires minor corrections.
Some corrections are needed in original article.
The original version of this article unfortunately contained a mistake in Fig. 4(b) and Fig. 5(b). On the Y-axis, (states/eV) should be F(w)(states/eV). The original article has been corrected.
We provide corrections and complements to [1, §4]: Formulas (29) and, especially, (31) must be amended, as explained in §3 and §4 below.
The reference for number 27 was incorrect. The correct reference is: 27. R. Sarkar, P. Gupta, S. Basu, and N.B. Ballal: Metall. Mater. Trans. B, 2015, vol. 46B, pp. 961–76.
The section “Acknowledgments” was incorrect in the original article. The correct section “Acknowledgments” is given below.
Luiz F.P. Pereira’s name appeared incorrectly on the original publication of this article. It has been corrected here.
The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as 'TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT'.
In the original publication the last column of the table 2 is aligned incorrectly. The correct version of table 2 is given below.
The following information is missing from the Funding footnote on the first page of the published article: “This study was partly funded by NIH RO1 HL092985.” The last/corresponding author is incorrectly listed on the first page of the published article: The correct name is Abraham MR.
In the article “The sTOF, a Favorable Geometry for a Time-of-Flight Analyzer”, the electric sectors in the prototype analyzer used to generate the data in Figure 4 were mistakenly listed as having a radius of 165 mm. The correct size is a diameter of 165 mm.
We develop methods to perform loop calculations in light cone perturbation theory using a helicity basis, refining the method introduced in our earlier work. In particular this includes implementing a consistent way to contract the four-dimensional tensor structures from the helicity vectors with d-dimensional tensors arising from loop integrals, in a way that can be fully automatized. We demonstrate this explicitly by calculating the one-loop correction to the virtual photon to quark–antiquark dipole light cone wave function. This allows us to calculate the deep inelastic scattering cross section in the dipole formalism to next-to-leading order accuracy. Our results, obtained using the four dimensional helicity scheme, agree with the recent calculation by Beuf using conventional dimensional regularization, confirming the regularization scheme independence of this cross section.
A quantum hydrodynamic model for charge transport in graphene is derived from a moment expansion of the Wigner–Boltzmann equation. The needed closure relations are obtained by adding quantum corrections based on the equilibrium Wigner function to the semiclassical model formulated in Camiola and Romano (2014) and Luca and Romano (2018) [2,3] by exploiting the Maximum Entropy Principle. The expression of the equilibrium Wigner function which takes into account the energy band of graphene has been obtained by solving the corresponding Bloch equation.
Low-concentration plutonium isotopic measurements provide a valuable fingerprint to identify possible material origins in the context of environmental contamination monitoring, environmental tracing, nuclear safeguards, nuclear forensics, and treaty monitoring. Thermal ionization mass spectrometry (TIMS) has long been recognized as one of the most sensitive techniques for plutonium isotopic measurement, but has not generally been utilized for 238 Pu determination, especially at low concentrations, due to an isobaric interference from 238 U, prevalent as background. Here, this work demonstrates a new analytical technique for correction of background 238 U from the 238 Pu counts collected during a TIMS analysis. The technique takes advantage of the higher ionization temperature of U relative to Pu and uses a 235 U tracer added after plutonium purification chemistry for 238 U semi-quantitative determination. This technique has been successfully applied to the determination of 238 Pu concentration and the 238 Pu/ 239 Pu ratio in sample types including single-isotope standards, isotopic certified reference materials, matrix-containing environmental reference materials, and simulated nuclear detonation debris. The results have been directly compared on a sample-by-sample basis to alpha spectrometry results. The detection limit by this new technique is 0.23 fg 238 Pu, which was previously unachievable by mass spectrometry and is possible in around 1 h of analysis time post-chemistry compared to weeks of required counting time by alpha spectrometry (at the same atom amount). We also present original, high precision data for Pu isotope concentrations in IAEA-384, Fangataufa Sediment, including 242 Pu results for the first time. The new technique allows measurement of a key isotope, 238 Pu, that was previously not measured in small environmental or nuclear forensics collections.
In this paper, we continue our efforts to exploit optimization and control ideas as a common foundation for the development of property-preserving numerical methods. Here we focus on a class of scalar advection equations whose solutions have fixed mass in a given Eulerian region and constant bounds in any Lagrangian volume. Our approach separates discretization of the equations from the preservation of their solution properties by treating the latter as optimization constraints. This relieves the discretization process from having to comply with additional restrictions and makes stability and accuracy the sole considerations in its design. A property-preserving solution is then sought as a state that minimizes the distance to an optimally accurate but not property-preserving target solution computed by the scheme, subject to constraints enforcing discrete proxies of the desired properties. Furthermore, we consider two such formulations in which the optimization variables are given by the nodal solution values and suitably defined nodal fluxes, respectively. A key result of the paper reveals that a standard Algebraic Flux Correction (AFC) scheme is a modified version of the second formulation obtained by shrinking its feasible set to a hypercube. In conclusion, we present numerical studies illustrating the optimization-based formulations and comparing them with AFC
The present study aimed to investigate the effect of heterogeneity correction (HC) on dosimetric parameters in 3-dimensional conformal radiotherapy planning for patients with thoracic esophageal cancer. We retrospectively analyzed 20 patients. Two treatment plans were generated for each patient using a superposition algorithm on the Xio radiotherapy planning system. The first plan was calculated without HC. The second was a new plan calculated with HC, using identical beam geometries and maintaining the same number of monitor units as the first. With regard to the planning target volume (PTV), the overall mean differences in the prescription dose, maximum dose, mean dose, and dose that covers 95% of the PTV between the first and second plans were 1.10 Gy (1.8%), 1.35 Gy (2.2%), 1.10 Gy (1.9%), and 0.56 Gy (1.0%), respectively. With regard to parameters related to the organs at risk (OARs), the mean differences in the absolute percentages of lung volume receiving greater than 5, 10, 20, and 30 Gy (lung V{sub 5}, V{sub 10}, V{sub 20}, and V{sub 30}) between the first and second plans were 7.1%, 2.7%, 0.4%, and 0.5%, respectively. These results suggest that HC might have a more pronounced effect on the percentages of lung volume receiving lower doses (e.g., V{sub 5} and V{sub 10}) than on the dosimetric parameters related to the PTV and other OARs.