Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “SLATER METHOD”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 163 records · Page 9
All sourcesNASA NTRSDOE OSTI
DOE OSTI2019

Half-Metallic Ferrimagnetism in CoFeNbZ (Z = Al, Si, Ge, Sn) Quaternary Heusler Alloys: a DFT Study

First principles calculations based on density functional theory is used to study the structural, electronic, and magnetic properties of novel CoFeNbZ (Z = Al, Si, Ge, Sn) quaternary Heusler alloys with the full-potential linearized augmented plane wave (FP-LAPW) method. The exchange-correlation effects are treated using generalized gradient approximation (GGA) to study the structural properties. With GGA as the exchange-correlation potential, CoFeNbAl and CoFeNbSn are half-metallic with 100% spin polarization, whereas CoFeNbSi and CoFeNbGe are nearly half-metallic with high spin polarization of 90.06 and 98.28% respectively. For CoFeNbAl and CoFeNbSn, the spin-flip gap increases with the use of modified Becke-Johnson potential. Using this approximation, CoFeNbGe is a half-metal with a spin-flip gap of 0.303 eV. The magnetic properties indicate that all the compounds follow the M{sub t} = Z{sub t} - 24 Slater-Pauling rule. The half-metallic behavior is maintained over a relatively wide range of lattice constants against hydrostatic strain. The transport properties of half-metallic CoFeNbZ (Z = Al, Ge, Sn) compounds are reported. Our present work has the potential to trigger the design of quaternary Heusler alloys with applications in spintronic devices.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
NASA NTRS2000

The NPARC Alliance Verification and Validation Archive

The NPARC Alliance (National Project for Applications oriented Research in CFD) maintains a publicly-available, web-based verification and validation archive as part of the development and support of the WIND CFD code. The verification and validation methods used for the cases attempt to follow the policies and guidelines of the ASME and AIAA. The emphasis is on air-breathing propulsion flow fields with Mach numbers ranging from low-subsonic to hypersonic.

Slater, John W.↗
DOE OSTI2018

First-Principles Study in New Hf{sub 2}CoZ (Z = B, C, Al, Si, Ga, Ge, In, Sn, Tl, and Pb) Heusler Alloys

The full-potential linearized augmented plane wave method within density functional theory was used to investigate the electronic structures, magnetic properties, and half-metallicity in Hf{sub 2}CoZ (Z = B,C, Al, Si, Ga, Ge, In, Sn, Tl, and Pb) alloys with AlCu{sub 2}Mn- and CuHg{sub 2}Ti-type structures. The AlCu{sub 2}Mn-type structure is energetically favorable than the CuHg{sub 2}Ti-type structure for all compounds. Hf{sub 2}CoGa, Hf{sub 2}CoAl, Hf{sub 2}CoIn, Hf{sub 2}CoTl, and Hf{sub 2}CoSn compounds in the CuHg{sub 2}Ti-type structure were half-metallic ferromagnets. The d-d and covalent hybridizations between transition metals Hf and Co were effective in the formation of minority band gap. The total magnetic moments of half-metallic Hf{sub 2}CoZ (Z = Al, Ga, In, Sn, and Tl) compounds in the CuHg{sub 2}Ti-type structure obeyed the Slater–Pauling rule (M{sub tot} = Z{sub tot} − 18). Hf{sub 2}CoIn and Hf{sub 2}CoTl compounds were half-metals in relatively wide ranges of lattice constants which indicates that they can be promising and interesting candidates for spintronic devices.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
NASA NTRS1986

Spectroradiometric calibration of the thematic mapper and multispectral scanner system

A list of personnel who have contributed to the program is provided. Sixteen publications and presentations are also listed. A preprint summarizing five in-flight absolute radiometric calibrations of the solar reflective bands of the LANDSAT-5 Thematic Mapper is presented. The 23 band calibrations made on the five dates show a 2.5% RMS variation from the mean as a percentage of the mean. A preprint is also presented that discusses the reflectance-based results of the above preprint. It proceeds to analyze and present results of a second, independent calibration method based on radiance measurements from a helicopter. Radiative transfer through the atmosphere, model atmospheres, the calibration methodology used at White Sands and the results of a sensitivity analysis of the reflectance-based approach is also discussed.

Slater, Philip N.↗
NASA NTRS1999

NPARC v3.1 User's Guide: A Companion to the NPARC v3.0 User's Guide

NPARC v3.1 is a modification to the NPARC v3.0 computer program which expands the capabilities for time-accurate computations through the use of a Newton iterative implicit method, time-varying boundary conditions, and planar dynamic grids. This document discusses some of the changes from the NPARC v3.0, specifically: changes to the directory structure and execution, changes to the input format. background on new methods, new boundary conditions. dynamic grids, new options for output, usage concepts, and some test cases to serve as tutorials. This document is intended to be used in conjunction with the NPARC v3.0 user's guide.

Chung, Joongkee↗
DOE OSTI2021

Evaluation of riverbed magnetic susceptibility for mapping biogeochemical hot spots in groundwater‐impacted rivers

Abstract Redox hot spots occurring as metal‐rich anoxic groundwater discharges through oxic wetland and river sediments commonly result in the formation of iron (Fe) oxide precipitates. These redox‐sensitive precipitates influence the release of nutrients and metals to surface water and can act as ‘contaminant sponges’ by absorbing toxic compounds. We explore the feasibility of a non‐invasive, high‐resolution magnetic susceptibility (MS) technique to efficiently map the spatial variations of magnetic Fe oxide precipitates in the shallow bed of three rivers impacted by anoxic groundwater discharge. Laboratory analyses on Mashpee River (MA, USA) sediments demonstrate the sensitivity of MS to sediment Fe concentrations. Field surveys in the Mashpee and Quashnet rivers (MA, USA) reveal several discrete high MS zones, which are associated with likely anoxic groundwater discharge as evaluated by riverbed temperature, vertical head gradient, and groundwater chemistry measurements. In the East River (CO, USA), widespread cobbles/rocks exhibit high background MS from geological ferrimagnetic minerals, thereby obscuring the relatively small enhancement of MS from groundwater induced Fe oxide precipitates. Our study suggests that, in settings with low geological sources of magnetic minerals such as lowland rivers and wetlands, MS may serve as a complementary tool to temperature methods for efficiently mapping Fe oxide accumulation zones due to anoxic groundwater discharges that may function as biogeochemical hot spots and water quality control points in gaining systems.

Wang, Chen↗
NASA NTRS1972

The design, construction and testing of the optics for a 147-cm-aperture telescope

Geodetic optics research for the Air Force Cambridge Research Laboratories (AFCRL) is described. The work consisted mainly of the fabrication of the optical components for a telescope with a 152-cm-diam (60-in.) primary mirror masked down to 147-cm-diam for use by the AFCRL for a lunar ranging experiment. Among the achievements of this contract were the following: completion of the primary and secondary mirrors for a high-quality 147-cm-diam telescope system in eight months from the start of edging the primary; manufacture and testing of a unique center mount for the primary according to an AFCRL design that allowed for a thin-edged and therefore less-massive mirror; and development of a quantitative analysis of the wire test for calculating the departure of the mirror figure from the design figure quickly and accurately after each polishing step. This analysis method in conjunction with a knowledge of polishing rates for given weights and diameters of tools, mirror, and polishing materials should considerably reduce the polishing time required for future large mirrors.

Buchroeder, R. A.↗
NASA NTRS1991

Solar-diffuser panel and ratioing radiometer approach to satellite sensor on-board calibration

The use of a solar-diffuser panel is a desirable approach to the on-board absolute radiometric calibration of satellite multispectral sensors used for earth observation in the solar reflective spectral range. It provides a full aperture, full field, end-to-end calibration near the top of the sensor's dynamic range and across its entire spectral response range. A serious drawback is that the panel's reflectance, and the response of any simple detector used to monitor its reflectance may change with time. This paper briefly reviews some preflight and on-board methods for absolute calibration and introduces the ratioing-radiometer concept in which the radiance of the panel is ratioed with respect to the solar irradiance at the time the multispectral sensor is viewing the panel in its calibration mode.

Slater, Philip N.↗
DOE OSTI2018

Study of Electronic Structure, Magnetism, and Half-Metallicity of New Heusler Compounds CsTmO{sub 2} (Tm = Fe, Co, Ni, and Cu)

The density functional calculations were performed using the full-potential linearized augmented plane wave (FPLAPW) method for new Heusler alloys CsTmO{sub 2} (Tm = Fe, Co, Ni, and Cu). All compounds were stable in FM AlCu{sub 2}Mn-type structure. Results revealed that these alloys can be experimentally synthesized according to the calculated cohesive and formation energies. CsTmO{sub 2} (Tm = Fe, Co, Ni, and Cu) alloys in AlCu{sub 2}Mn-type and CuHg{sub 2}Ti-type structures were half-metallic ferromagnets. The origin of half-metallicity in CsNiO{sub 2} alloy was also discussed. The total magnetic moment of CsTmO{sub 2} (Tm = Fe, Co, Ni, and Cu) alloys in both structures were 3 μ{sub B} per formula unit and obeyed the Slater-Pauling rule (M{sub tot} = 22 − Z{sub tot}). The relationship between the magnetism and half-metallicity of all compounds and the lattice constants was also studied. The half-metallic character in combined alloys CsTmO{sub 2} (Tm = Fe, Co, Ni, and Cu) improved in comparison with Heusler alloys including transition metals which indicated that they may be good candidates for practical applications in spintronics.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2020

Extending the Gutzwiller approximation to intersite interactions

In this work, we develop an extension of the Gutzwiller approximation (GA) formalism that includes the effects of Coulomb interactions of arbitrary range (including density density, exchange, pair hopping, and Coulomb-assisted hopping terms). This formalism reduces to the ordinary GA formalism for the multiband Hubbard models in the presence of only local interactions. This is accomplished by combining the 1 / z expansion—where z is the coordination number, and only the leading-order terms contribute in the limit of infinite dimensions—with a P R † P R - I expansion, where P R is the Gutzwiller projector on the site R . Furthermore, the method is conveniently formulated in terms of a Gutzwiller Lagrange function. We apply our theory to the extended single-band Hubbard model. Similarly to the usual Brinkman-Rice mechanism, we find a Mott transition. A valence skipping transition is observed, where the occupation of the empty and doubly occupied states for the Gutzwiller wave function is enhanced with respect to the uncorrelated Slater determinant wave function.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2018

Electronic Structures, Magnetic Properties and Half-Metallicity of Heusler Compounds Hf{sub 2}VZ (Z = Ga, In, Tl, Si, Ge, Sn and Pb): First-Principle Calculations

We investigate the electronic structures, magnetic properties and half-metallicity of Heusler compounds Hf{sub 2}VZ (Z = Ga, In, Tl, Si, Ge, Sn and Pb) with Hg{sub 2}CuTi-type structure by using the first-principle calculations based on density-functional theory. It is found that the equilibrium lattice constants of Hf{sub 2}VZ (Z = Ga, In, Tl, Si, Ge, Sn and Pb) compounds are 6.68, 6.88, 6.91, 6.57, 6.63, 6.85 and 6.94 Å, respectively. Hf{sub 2}VZ (Z = Ga, In, Tl, Si and Sn) compounds exhibit half-metallicity at their respective equilibrium lattice constants. Hf{sub 2}VGe and Hf{sub 2}VPb do not exhibit half-metallicity at their equilibrium lattice constants but can present the half-metallicity when the lattice constant decreases to 6.51 and 6.71 Å, respectively. In case of the lattice thermal expansion, the half-metallicity can be kept in the range of 6.30∼ 7.27, 6.36∼ 7.80, 6.46∼ 7.35, 6.00∼ 6.70 and 6.10∼ 6.95 Å (lattice constant) for Hf{sub 2}VZ (Z = Ga, In, Tl, Si and Sn). Under the unaxial strain, the half-metallicity can still be kept for Hf{sub 2}VZ (Z = Ga, In, Tl) when the lattice distortion is up to ± 10% (c/a) and be kept for Hf{sub 2}VZ (Z = Si, Sn) when the lattice distortion is 0.88∼ 1.09, 0.91∼ 1.09 (c/a). For the Hf{sub 2}VZ compounds with half-metallicity, the total magnetic moment is 2 μ{sub B} when Z is the third main group elements and is 1 μ{sub B} when Z is the fourth main group elements. The Hf{sub 2}VZ compounds with half-metallicity obey the Slater-Pauling formula: M{sub t} = 18 − Z{sub t} rule.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
NASA NTRS1991

Calibrated intercepts for solar radiometers used in remote sensor calibration

Calibrated solar radiometer intercepts allow spectral optical depths to be determined for days with intermittently clear skies. This is of particular importance on satellite sensor calibration days that are cloudy except at the time of image acquisition. This paper describes the calibration of four solar radiometers using the Langley-Bouguer technique for data collected on days with a clear, stable atmosphere. Intercepts are determined with an uncertainty of less than six percent, corresponding to a maximum uncertainty of 0.06 in optical depth. The spread of voltage intercepts calculated in this process is carried through three methods of radiometric calibration of satellite sensors to yield an uncertainty in radiance at the top of the atmosphere of less than one percent associated with the uncertainty in solar radiometer intercepts for a range of ground reflectances.

Gellman, David I.↗
DOE OSTI2016

Internal twisting motion dependent conductance of an aperiodic DNA molecule

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from a base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2018

Study of the Electronic Structure, Magnetic and Elastic Properties and Half-Metallic Stability on Variation of Lattice Constants for CoFeCrZ (Z = P, As, Sb) Heusler Alloys

Structural, elastic, magnetic and electronic properties of CoFeCrZ (Z = P, As, Sb) Heusler alloys in their YI-type structure have been computed by density functional theory-based WIEN2k code within generalized gradient approximation for exchange correlation functions. Values of formation energy and elastic constants verify the stability of these alloys. True half metallic ferromagnetic behaviour with 100% spin polarization and good band gap in the minority spin are obtained for all the alloys. Magnetic moment of these alloys is 4.00 μ{sub B}, which matches well with the value predicted from Slater-Pauling rule. Half-metallicity is maintained over a wide range of lattice constants making these alloys promising for spintronics device applications.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
NASA NTRS1995

A Combined Geometric Approach for Computational Fluid Dynamics on Dynamic Grids

A combined geometric approach for computational fluid dynamics is presented for the analysis of unsteady flow about mechanisms in which its components are in moderate relative motion. For a CFD analysis, the total dynamics problem involves the dynamics of the aspects of geometry modeling, grid generation, and flow modeling. The interrelationships between these three aspects allow for a more natural formulation of the problem and the sharing of information which can be advantageous to the computation of the dynamics. The approach is applied to planar geometries with the use of an efficient multi-block, structured grid generation method to compute unsteady, two-dimensional and axisymmetric flow. The applications presented include the computation of the unsteady, inviscid flow about a hinged-flap with flap deflections and a high-speed inlet with centerbody motion as part of the unstart / restart operation.

Slater, John W.↗
DOE OSTI2016

Simple formalism for efficient derivatives and multi-determinant expansions in quantum Monte Carlo

We present a simple and general formalism to compute efficiently the derivatives of a multi-determinant Jastrow-Slater wave function, the local energy, the interatomic forces, and similar quantities needed in quantum Monte Carlo. Through a straightforward manipulation of matrices evaluated on the occupied and virtual orbitals, we obtain an efficiency equivalent to algorithmic differentiation in the computation of the interatomic forces and the optimization of the orbital parameters. Furthermore, for a large multi-determinant expansion, the significant computational gain afforded by a recently introduced table method is here extended to the local value of any one-body operator and to its derivatives, in both all-electron and pseudopotential calculations.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2022

Electronic structure of α - RuCl 3 by fixed-node and fixed-phase diffusion Monte Carlo methods

Layered material α-RuCl 3 has caught wide attention due to its possible realization of Kitaev's spin liquid and its electronic structure that involves the interplay of electron-electron correlations and spin-orbit effects. Several DFT+U studies have suggested that both electron-electron correlations and spin-orbit effects are crucial for accurately describing the band gap. This work studies the importance of these two effects using fixed-node and fixed-phase diffusion Monte Carlo calculations both in spin-averaged and explicit spin-orbit formalisms. In the latter, the Slater-Jastrow trial function is constructed from two-component spin orbitals using our recent quantum Monte Carlo (QMC) developments and thoroughly tested effective core potentials. Our results show that the gap in the ideal crystal is already accurately described by the spin-averaged case, with the dominant role being played by the magnetic ground state with significant exchange and electron correlation effects. We find qualitative agreement between hybrid DFT, DFT+U, and QMC. In addition, QMC results agree very well with available experiments, and we identify the values of exact Fock exchange mixing that provide comparable gaps. Explicit spin-orbit QMC calculations reveal that the effect of spin-orbit coupling on the gap is minor, of the order of 0.2 eV, which corresponds to the strength of the spin orbit of the Ru atom.

36 MATERIALS SCIENCE↗
DOE OSTI2022

Quantification of electron correlation for approximate quantum calculations

State-of-the-art many-body wave function techniques rely on heuristics to achieve high accuracy at an attainable computational cost to solve the many-body Schrödinger equation. By far, the most common property used to assess accuracy has been the total energy; however, total energies do not give a complete picture of electron correlation. In this work, we assess the von Neumann entropy of the one-particle reduced density matrix (1-RDM) to compare selected configuration interaction (CI), coupled cluster, variational Monte Carlo, and fixed-node diffusion Monte Carlo for benchmark hydrogen chains. A new algorithm, the circle reject method, is presented, which improves the efficiency of evaluating the von Neumann entropy using quantum Monte Carlo by several orders of magnitude. The von Neumann entropy of the 1-RDM and the eigenvalues of the 1-RDM are shown to distinguish between the dynamic correlation introduced by the Jastrow and the static correlation introduced by determinants with large weights, confirming some of the lore in the field concerning the difference between the selected CI and Slater–Jastrow wave functions.

Chemistry↗