Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “STRESSES”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,369 records · Page 76
All sourcesNASA NTRSDOE OSTI
DOE OSTI2023

Potential induced degradation in c-Si glass-glass modules after extended damp heat stress

Traditional Glass-Backsheet (GB) photovoltaic (PV) modules have been the industry standard for a long time, but the Glass-Glass (GG) modules are quickly rising in popularity. PV modules installed in hot-humid climates with high string voltages can undergo potential induced degradation (PID). So far, to the best of our knowledge, only fresh modules with strong interfacial adhesion have been investigated for PID. However, in reality, the PV modules have weak interfacial adhesion after a few years of field exposure. Therefore, it is essential to evaluate PV modules with weakened interfaces. In this study, we investigated the PID susceptibility of PV modules with weakened interfaces after subjecting them to 2000 hours of damp heat (DH2000) at 85°C/85% relative humidity (RH) in an accelerated environmental chamber. Fresh GG modules were also stressed for PID to compare with PID degradation of DH-stressed modules. Pre- and post-characterization tests were done before, between, and after each stress method to determine the changes in electrical performance, cell metallization properties, and hotspot properties. It is observed that fresh GG modules showed little/no degradation (less than 1%) in maximum power (Pmax), whereas the GG modules that underwent sequential DH and PID degraded by 11% to 12%. Potential mechanisms for these degradations are also presented. Furthermore, the results presented in this study are critical for the industry, considering that the bifacial modules with GG construction will be dominant in the next 10 years.

14 SOLAR ENERGY↗
DOE OSTI2025

Stress accommodation in nanoscale dolan bridges designed for superconducting qubits

Josephson junctions are the principal circuit element in numerous superconducting quantum information devices and can be readily integrated into large-scale electronics. However, device integration at the wafer scale necessarily depends on having a reliable, high-fidelity, and high-yield fabrication method for creating Josephson junctions. When creating Al/AlO x based superconducting qubits, the standard Josephson junction fabrication method relies on a sub-micron suspended resist bridge, known as a Dolan bridge, which tends to be particularly fragile and can often times fracture during the resist development process, ultimately resulting in device failure. In this work, we demonstrate a unique Josephson junction lithography mask design that incorporates stress-relief channels. Our simulation results show that the addition of stress-relief channels reduces the lateral stress in the Dolan bridge by more than 70% for all the bridge geometries investigated. In practice, our novel mask design significantly increased the survivability of the bridge during device processing, resulting in 100% yield for over 100 Josephson junctions fabricated.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2024

Thermal Transport and Mechanical Stress Mapping of a Compression Bonded GaN/Diamond Interface for Vertical Power Devices

Bonding diamond to the back side of gallium nitride (GaN) electronics has been shown to improve thermal management in lateral devices; however, engineering challenges remain with the bonding process and characterizing the bond quality for vertical device architectures. Here, in this study, integration of these two materials is achieved by room-temperature compression bonding centimeter-scale GaN and a diamond die via an intermetallic bonding layer of Ti/Au. Recent attempts at GaN/diamond bonding have utilized a modified surface activation bonding (SAB) method, which requires Ar fast atom bombardment immediately followed by bonding within the same tool under ultrahigh vacuum (UHV) conditions. The method presented here does not require a dedicated SAB tool yet still achieves bonding via a room-temperature metal–metal compression process. Imaging of the buried interface and the total bonding area is achieved via transmission electron microscopy (TEM) and confocal acoustic scanning microscopy (C-SAM), respectively. The thermal transport quality of the bond is extracted from spatially resolved frequency-domain thermoreflectance (FDTR) with the bonded areas boasting a thermal boundary conductance of >100 MW/m 2 ·K. Additionally, Raman maps of GaN near the GaN–diamond interface reveal a low level of compressive stress, <80 MPa, in well-bonded regions. FDTR and Raman were coutilized to map these buried interfaces and revealed some poor thermally bonded areas bordered by high-stress regions, highlighting the importance of spatial sampling for a complete picture of bond quality. Overall, this work demonstrates a novel method for thermal management in vertical GaN devices that maintains low intrinsic stresses while boasting high thermal boundary conductances.

Raman↗
DOE OSTI2023

Accounting for Changes in Radiation Improves the Ability of SIF to Track Water Stress-Induced Losses in Summer GPP in a Temperate Deciduous Forest

Global observations of solar-induced chlorophyll fluorescence (SIF) are available from multiple satellite platforms, and SIF is increasingly used as a proxy for photosynthetic activity and ecosystem productivity. Because the relationship between SIF and gross primary productivity (GPP) depends on a variety of factors including ecosystem type and environmental conditions, it is necessary to study SIF observations across various spatiotemporal scales and ecosystems. To explore how SIF signals relate to productivity over a temperate deciduous forest, we deployed a PhotoSpec spectrometer system at the University of Michigan Biological Station AmeriFlux site (US-UMB) in the northern Lower Peninsula of Michigan during the 2018 and 2019 growing seasons. We found that SIF correlated with GPP across diurnal and seasonal cycles (R 2 = 0.61 and 0.64 for 90-min- and daily-averaged data), but that SIF signals were more strongly related to downwelling radiation than GPP (R 2 = 0.91 for daily-averaged data). The dependence of SIF on radiation obscured the impact of intraseasonal drought in the SIF timeseries, but drought stress was apparent as a decrease in relative SIF, which exhibited a stronger correlation with GPP (R 2 = 0.56) than other remotely sensed data over the drought period. These results highlight the potential of SIF for detecting stress-induced losses in forest productivity. Additionally, we found that the red:far-red SIF ratio did not exhibit a response to water stress-induced losses in productivity, but was largely driven by seasonal and interannual changes in canopy structure, as well as by synoptic changes in downwelling radiation.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2023

Urban Versus Lake Impacts on Heat Stress and Its Disparities in a Shoreline City

Abstract Shoreline cities are influenced by both urban‐scale processes and land‐water interactions, with consequences on heat exposure and its disparities. Heat exposure studies over these cities have focused on air and skin temperature, even though moisture advection from water bodies can also modulate heat stress. Here, using an ensemble of model simulations covering Chicago, we find that Lake Michigan strongly reduces heat exposure (2.75°C reduction in maximum average air temperature in Chicago) and heat stress (maximum average wet bulb globe temperature reduced by 0.86°C) during the day, while urbanization enhances them at night (2.75 and 1.57°C increases in minimum average air and wet bulb globe temperature, respectively). We also demonstrate that urban and lake impacts on temperature (particularly skin temperature), including their extremes, and lake‐to‐land gradients, are stronger than the corresponding impacts on heat stress, partly due to humidity‐related feedback. Likewise, environmental disparities across community areas in Chicago seen for skin temperature are much higher (1.29°C increase for maximum average values per $10,000 higher median income per capita) than disparities in air temperature (0.50°C increase) and wet bulb globe temperature (0.23°C increase). The results call for consistent use of physiologically relevant heat exposure metrics to accurately capture the public health implications of urbanization.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2021

Towards validation of combined-accelerated stress testing through failure analysis of polyamide-based photovoltaic backsheets

Abstract Novel methods for advancing reliability testing of photovoltaic (PV) modules and materials have recently been developed. Combined-accelerated stress testing (C-AST) is one such method which has demonstrated reliable reproduction of some field-failures which were not reproducible by standard certification tests. To increase confidence and assist in the development of C-AST, and other new testing protocols, it is important to validate that the failure modes observed and mechanisms induced are representative of those observed in the field, and not the product of unrealistic stress conditions. Here we outline a method using appropriate materials characterization and modelling to validate the failure mechanisms induced in C-AST such that we can increase confidence in the test protocol. The method is demonstrated by applying it to a known cracking failure of a specific polyamide (PA)-based backsheet material. We found that the failure of the PA-based backsheet was a result of a combination of stress factors. Photo-oxidation from ultra-violet (UV) radiation exposure caused a reduction in fracture toughness, which ultimately lead to the cracking failure. We show that the chemical and structural changes observed in the backsheet following C-AST aging were also observed in field-aged samples. These results increase confidence that the conditions applied in C-AST are representative of the field and demonstrates our approach to validating the failure mechanisms induced.

14 SOLAR ENERGY↗
DOE OSTI2022

Ultrafast laser filament-induced fluorescence for detecting uranium stress in Chlamydomonas reinhardtii

Abstract Plants and other photosynthetic organisms have been suggested as potential pervasive biosensors for nuclear nonproliferation monitoring. We demonstrate that ultrafast laser filament-induced fluorescence of chlorophyll in the green alga Chlamydomonas reinhardtii is a promising method for remote, in-field detection of stress from exposure to nuclear materials. This method holds an advantage over broad-area surveillance, such as solar-induced fluorescence monitoring, when targeting excitation of a specific plant would improve the detectability, for example when local biota density is low. After exposing C. reinhardtii to uranium, we find that the concentration of chlorophyll a, chlorophyll fluorescence lifetime, and carotenoid content increase. The increased fluorescence lifetime signifies a decrease in non-photochemical quenching. The simultaneous increase in carotenoid content implies oxidative stress, further confirmed by the production of radical oxygen species evidence in the steady-state absorption spectrum. This is potentially a unique signature of uranium, as previous work finds that heavy metal stress generally increases non-photochemical quenching. We identify the temporal profile of the chlorophyll fluorescence to be a distinguishing feature between uranium-exposed and unexposed algae. Discrimination of uranium-exposed samples is possible at a distance of $$\sim $$ ∼ 35 m with a single laser shot and a modest collection system, as determined through a combination of experiment and simulation of distance-scaled uncertainty in discriminating the temporal profiles. Illustrating the potential for remote detection, detection over 125 m would require 100 laser shots, commensurate with the detection time on the order of 1 s.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2026

Intermediate time sub-diffusion and stress relaxation in ring polymer melts

The slow dynamics of non-concatenated ring melts remains a frontier problem in polymer science with implications for many soft material environments including cellular biophysics. Here, in this work, we report large-scale simulations of model ring melts that analyze the monomer and center-of-mass (CM) mean square displacements (MSD) and stress relaxation function on intermediate time and length scales. The degree of dynamical slowing down is characterized by the maximally sub-diffusive fractional time scaling exponents. The data span an exceptionally wide range of ring degrees of polymerization and stiffnesses and are not successfully organized based on the classic measure linear chain entanglement, N/N e . Rather, we find that the crossover degree of polymerization, N D , based on ring macromolecular caging that successfully allows master curves to be constructed for the long-time CM self-diffusion constant also collapses these temporal dynamic scaling exponents. Different properties display different exponents and exhibit one or two regimes of linear variation with the logarithm of N D / N . A distinct crossover of the CM-MSD and stress relaxation exponents emerges at sufficiently large N or stiffness that is not found for the monomer MSD, indicating a novel form of dynamic decoupling. This crossover aligns with the predicted critical degree of polymerization for transitioning from a weak to strong caging regime, indicative of activated transport. The latter may reflect the emergence of an intermolecular collective contribution to stress in analogy with dense soft colloidal matter. Suggestions are made for future theoretical work to address the rich patterns of behavior discovered.

Anomalous diffusion↗
DOE OSTI2023

The reference genome and abiotic stress responses of the model perennial grass Brachypodium sylvaticum

Abstract Perennial grasses are important forage crops and emerging biomass crops and have the potential to be more sustainable grain crops. However, most perennial grass crops are difficult experimental subjects due to their large size, difficult genetics, and/or their recalcitrance to transformation. Thus, a tractable model perennial grass could be used to rapidly make discoveries that can be translated to perennial grass crops. Brachypodium sylvaticum has the potential to serve as such a model because of its small size, rapid generation time, simple genetics, and transformability. Here, we provide a high-quality genome assembly and annotation for B. sylvaticum, an essential resource for a modern model system. In addition, we conducted transcriptomic studies under 4 abiotic stresses (water, heat, salt, and freezing). Our results indicate that crowns are more responsive to freezing than leaves which may help them overwinter. We observed extensive transcriptional responses with varying temporal dynamics to all abiotic stresses, including classic heat-responsive genes. These results can be used to form testable hypotheses about how perennial grasses respond to these stresses. Taken together, these results will allow B. sylvaticum to serve as a truly tractable perennial model system.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Molecular mechanisms and environmental adaptations of flagellar loss and biofilm growth of Rhodanobacter under environmental stress

Biofilms aid bacterial adhesion to surfaces via direct and indirect mechanisms, and formation of biofilms is considered as an important strategy for adaptation and survival in suboptimal environmental conditions. However, the molecular underpinnings of biofilm formation in subsurface sediment/groundwater ecosystems where microorganisms often experience fluctuations in nutrient input, pH, and nitrate or metal concentrations are underexplored. Here, we examined biofilm formation under different nutrient, pH, metal, and nitrate regimens of 16 Rhodanobacter strains isolated from subsurface groundwater wells spanning diverse levels of pH (3.5 to 5) and nitrates (13.7 to 146 mM). Eight Rhodanobacter strains demonstrated significant biofilm growth under low pH, suggesting adaptations for survival and growth at low pH. Biofilms were intensified under aluminum stress, particularly in strains possessing fewer genetic traits associated with biofilm formation, findings warranting further investigation. Through random barcode transposon-site sequencing (RB-TnSeq), proteomics, use of specific mutants, and transmission electron microscopy analysis, we discovered flagellar loss under aluminum stress, indicating a potential relationship between motility, metal tolerance, and biofilm growth. Comparative genomic analyses revealed the absence of flagella and chemotaxis genes and the presence of a putative type VI secretion system in the highly biofilm-forming strain FW021-MT20. In this study we identified genetic determinants associated with biofilm growth under metal stress in a predominant environmental genus, Rhodanobacter, and identified traits aiding survival and adaptation to contaminated subsurface environments.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Role of point defects in stress-induced martensite transformations in NiTi shape memory alloys: A molecular dynamics study

Shape-memory properties of equiatomic NiTi rely on the thermal- or stress-induced reversible martensitic phase transformation between the $\textit{B}$2 and $\textit{B}$19' phases. Irradiation defects suppress thermal-induced transformations, but their effects on stress-induced transformations are poorly understood. In this work, we use molecular dynamics to investigate the effect of vacancies, vacancy clusters, interstitials, and antisite defects on stress-induced transformations. All defects suppress the transformation, but vacancy clusters do so to the greatest extent, while antisite defects do so to the least extent. The responsible mechanisms are grain boundary pinning and chemical disordering.

36 MATERIALS SCIENCE↗
DOE OSTI2020

Shear Softening in a Metallic Glass: First-Principles Local-Stress Analysis

Metallic glasses deform elastically under stress. However, the atomic-level origin of elastic properties of metallic glasses remain unclear. In this Letter using ab initio molecular dynamics simulations of the Cu 5 0Zr 50 metallic glass under shear strain, we show that the heterogeneous stress relaxation results in the increased charge transfer from Zr to Cu atoms, enhancing the softening of the shear modulus. Changes in compositional short-range order and atomic position shifts due to the nonaffine deformation are discussed. It is shown that the Zr subsystem exhibits a stiff behavior, whereas the displacements of Cu atoms from their initial positions, induced by the strain, provide the stress drop and softening.

36 MATERIALS SCIENCE↗
DOE OSTI2024

Spot pattern welding scanning strategy for sensor embedding and residual stress reduction in laser-foil-printing additive manufacturing

Here, this paper aims to present spot pattern welding (SPW) as a scanning strategy for laser-foil-printing (LFP) additive manufacturing (AM) in place of the previously used continuous pattern welding (CPW) (line-raster scanning). The SPW strategy involves generating a sequence of overlapping spot welds on the metal foil, allowing the laser to form dense and uniform weld beads. This in turn reduces thermal gradients, promotes material consolidation and helps mitigate process-related risks such as thermal cracking, porosity, keyholing and Marangoni effects. 304L stainless steel (SS) feedstock is used to fabricate test specimens using the LFP system. Imaging techniques are used to examine the melt pool dimensions and layer bonding. In addition, the parts are evaluated for residual stresses, mechanical strength and grain size. Compared to CPW, SPW provides a more reliable heating/cooling relationship that is less dependent on part geometry. The overlapping spot welds distribute heat more evenly, minimizing the risk of elevated temperatures during the AM process. In addition, the resulting dense and uniform weld beads contribute to lower residual stresses in the printed part. To the best of the authors’ knowledge, this is the first study to thoroughly investigate SPW as a scanning strategy using the LFP process. In general, SPW presents a promising strategy for securing embedded sensors into LFP parts while minimizing residual stresses.

36 MATERIALS SCIENCE↗
DOE OSTI2020

On the nonlinear temperature dependence of residual stresses in solid oxide fuel cells

The residual stresses in a dense yttria-stabilized zirconia (YSZ) layer bonded to a porous NiO-YSZ substrate were measured by X-ray diffraction in air between 25°C and 900°C. In this work, it was found that the residual stresses on the outer surface of the YSZ layer were compressive, that their magnitude increased with decreasing temperature, and that the temperature dependence was nonlinear particularly at temperatures below 600°C. An elastic model that incorporates micromechanics and laminate theory was formulated to successfully predicts the nonlinearity of the temperature dependence of the residual stresses by accounting for the effect of the order-disorder transition experienced by YSZ around 600°C and the magnetic transition of NiO at the Néel temperature around 265°C, on the properties of these materials. The implications of the results for the reliability of solid oxide fuel cells are discussed.

25 ENERGY STORAGE↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

F‐Box Protein‐Mediated Proteolytic Regulation of Phenylpropanoid Metabolism in Response to Biotic and Abiotic Stresses

Protein ubiquitination is a central regulatory mechanism governing plant growth, development and environmental adaptation. Ubiquitylomic studies have revealed that many enzymes in phenylpropanoid biosynthetic pathways are subject to ubiquitination. Increasing evidence indicates that specific F-box proteins target key enzymes in these pathways, including PAL, CCR, CAD, COMT and peroxidases in the lignin biosynthetic branch, and CHS in the flavonoid biosynthetic branch, thereby promoting their ubiquitination and selective degradation. These F-box proteins act in response to diverse developmental and environmental cues, including cellular carbon status, light quality and intensity, and biotic stresses (e.g., pathogen and insect attack). By regulating the stability and activity of both enzymes and regulatory proteins involved in phenylpropanoid biosynthesis, F-box proteins modulate the accumulation of simple phenolics and lignin polymers, ultimately contributing to plant resilience. This review summarizes recent advances in the characterization of F-box proteins involved in phenylpropanoid metabolism and their regulatory roles in response to biotic and abiotic stresses and identifies key knowledge gaps that limit mechanistic understanding of F-box protein-mediated proteolytic regulation of phenylpropanoid metabolism. In conclusion, insights into ubiquitin-mediated proteolytic control of phenylpropanoid metabolism offer promising avenues for enhancing bioactive phenolic production, advancing biofuel feedstock engineering and improving crop stress tolerance.

(A)biotic stress↗
DOE OSTI2026

Single-cell proteomics of Arabidopsis leaf mesophyll reveals dynamic protein responses to water-deficit stress

Background The application of single-cell omics tools to biological systems can provide unique insights into diverse cellular populations and their heterogeneous responses to internal and external perturbations. Thus far, most single-cell studies in plant systems have been limited to RNA-sequencing approaches, which only provide indirect readouts of cellular functions. Results Here, we present a single-cell proteomics workflow for plant cells that integrates tape-sandwich protoplasting, piezoelectric cell sorting, nanoPOTS sample preparation, and ion mobility-based MS data acquisition method for label-free single-cell proteomics analysis of Arabidopsis leaf mesophyll cells. From a single leaf protoplast, over 3,000 proteins were quantified with high precision. The workflow is demonstrated to identify stress associated changes in protein abundance by analyzing 117 protoplasts from well-watered and water-deficit stressed plants. Additionally, we describe a new approach for constructing covarying protein networks at the single-cell level and demonstrate how single-cell protein covariation analysis can reveal previously unrecognized protein functions while also capturing stress-induced changes in protein–protein dynamics. Conclusions The label-free scProteomic approach presented here represents a significant advance through the demonstration of a facile protoplast isolation method combined with deep and precise proteomic coverage of Arabidopsis leaf mesophyll cell types. We believe this study will serve as an informative reference to future plant scProteomic investigations.

Arabidopsis↗
DOE OSTI2021

Processed Lab Data for Neural Network-Based Shear Stress Level Prediction

Machine learning can be used to predict fault properties such as shear stress, friction, and time to failure using continuous records of fault zone acoustic emissions. The files are extracted features and labels from lab data (experiment p4679). The features are extracted with a non-overlapping window from the original acoustic data. The first column is the time of the window. The second and third columns are the mean and the variance of the acoustic data in this window, respectively. The 4th-11th column is the the power spectrum density ranging from low to high frequency. And the last column is the corresponding label (shear stress level). The name of the file means which driving velocity the sequence is generated from. Data were generated from laboratory friction experiments conducted with a biaxial shear apparatus. Experiments were conducted in the double direct shear configuration in which two fault zones are sheared between three rigid forcing blocks. Our samples consisted of two 5-mm-thick layers of simulated fault gouge with a nominal contact area of 10 by 10 cm^2. Gouge material consisted of soda-lime glass beads with initial particle size between 105 and 149 micrometers. Prior to shearing, we impose a constant fault normal stress of 2 MPa using a servo-controlled load-feedback mechanism and allow the sample to compact. Once the sample has reached a constant layer thickness, the central block is driven down at constant rate of 10 micrometers per second. In tandem, we collect an AE signal continuously at 4 MHz from a piezoceramic sensor embedded in a steel forcing block about 22 mm from the gouge layer The data from this experiment can be used with the deep learning algorithm to train it for future fault property prediction.

15 GEOTHERMAL ENERGY↗