Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “toolkit”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,297 records · Page 72
All sourcesNASA NTRSDOE OSTI
DOE OSTI2016

Space-time development of electromagnetic and hadronic showers and perspectives for novel calorimetric techniques

The performance of hadronic calorimeters will be a key parameter at the next generation of High Energy Physics accelerators. A detector combining fine granularity with excellent timing information would prove beneficial for the reconstruction of both jets and electromagnetic particles with high energy resolution. In this work, the space and time structure of high energy showers is studied by means of a Geant4-based simulation toolkit. In particular, the relevant time scales of the different physics phenomena contributing to the energy loss are investigated. A correlation between the fluctuations of the energy deposition of high energy hadrons and the time development of the showers is observed, which allows for an event-by-event correction to be computed to improve the energy resolution of the calorimeter. Lastly, these studies are intended to set the basic requirements for the development of a new-concept, total absorption time-imaging calorimeter, which seems now within reach thanks to major technological advancements in the production of fast scintillating materials and compact photodetectors.

46 INSTRUMENTATION RELATED TO NUCLEAR SCIENCE AND ↗
DOE OSTI2017

Fresh Fuel Measurements With the Differential Die-Away Self-Interrogation Instrument

The purpose of the Next Generation Safeguards Initiative (NGSI)-Spent Fuel (SF) Project is to strengthen the technical toolkit of safeguards inspectors and/or other interested parties. Thus the NGSI-SF team is working to achieve the following technical goals more easily and efficiently than in the past using nondestructive assay measurements of spent fuel assemblies: 1) verify the initial enrichment, burnup, and cooling time of facility declaration; 2) detect the diversion or replacement of pins; 3) estimate the plutonium mass; 4) estimate decay heat; and 5) determine the reactivity of spent fuel assemblies. The differential die-away self-interrogation (DDSI) instrument is one instrument that was assessed for years regarding its feasibility for robust, timely verification of spent fuel assemblies. The instrument was recently built and was tested using fresh fuel assemblies in a variety of configurations, including varying enrichment, neutron absorber content, and symmetry. The early die-away method, a multiplication determination method developed in simulation space, was successfully tested on the fresh fuel assembly data and determined multiplication with a root-mean-square (RMS) error of 2.9%. The experimental results were compared with MCNP simulations of the instrument as well. Low multiplication assemblies had agreement with an average RMS error of 0.2% in the singles count rate (i.e., total neutrons detected per second) and 3.4% in the doubles count rates (i.e., neutrons detected in coincidence per second). High-multiplication assemblies had agreement with an average RMS error of 4.1% in the singles and 13.3% in the doubles count rates.

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2026

RADAI: A Large-Scale Realistic Dataset for Radiation Detection Algorithm Development

Open, realistic datasets are essential for developing and benchmarking radiation detection algorithms, yet they remain scarce. The Radiological Anomaly Detection and Identification (RADAI) project was develop to create datasets that meet the training and testing needs for sophisticated radiation detection algorithms. The RADAI dataset is a large-scale synthetic resource that integrates high-fidelity Monte Carlo simulations with realistic urban scenarios to capture both background variability and source signatures. RADAI models construction-material NORM, people and vehicles, urban clutter, and dynamic environmental effects such as cosmic-ray and rain-induced transients, and they provide list-mode detector data with motion and response modeling suitable for algorithm training and evaluation. The RADAI project resulted in three publicly-released complementary datasets together with an online scoring portal for standardized performance assessment and an open software toolkit that supports data access, augmentation, model development, and evaluation. These resources enable reproducible comparisons across methods and promote rigorous studies at the scale required by contemporary machine learning. By grounding algorithm development in realistic, well-documented conditions, RADAI supports progress toward more robust detection, identification, and localization in complex urban environments.

Ghawaly, James M. [Division of Computer Science an↗
DOE OSTI2025

GASP: Gradient-Aware Shortest Path Algorithm for Boundary-Confined 2-Manifold Reeb Graph Visualization

Reeb graphs are an important tool for abstracting and representing the topological structure of a function defined on a manifold. We have identified three properties for faithfully representing Reeb graphs in a visualization: they should be constrained to the boundary, compact, and aligned with the function gradient. Existing algorithms for drawing Reeb graphs are agnostic to or violate these properties. In this paper, we introduce an algorithm to generate Reeb graph visualizations, called GASP, that is cognizant of these properties, thereby producing visualizations that are more representative of the underlying data. To demonstrate the improvements, the resulting Reeb graphs are evaluated both qualitatively and quantitatively against the geometric barycenter algorithm, using its implementation available in the Topology ToolKit (TTK), a widely adopted tool for calculating and visualizing Reeb graphs.

Rahman, Sefat [University of Utah]↗
DOE OSTI2021

The PetscSF Scalable Communication Layer

PetscSF, the communication component of the Portable, Extensible Toolkit for Scientific Computation (PETSc), is designed to provide PETSc's communication infrastructure suitable for exascale computers that utilize GPUs and other accelerators. PetscSF provides a simple application programming interface (API) for managing common communication patterns in scientific computations by using a star-forest graph representation. PetscSF supports several implementations based on MPI and NVSHMEM, whose selection is based on the characteristics of the application or the target architecture. An efficient and portable model for network and intra-node communication is essential for implementing large-scale applications. The Message Passing Interface, which has been the de facto standard for distributed memory systems, has developed into a large complex API that does not yet provide high performance on the emerging heterogeneous CPU-GPU-based exascale systems. Here, we discuss the design of PetscSF, how it can overcome some difficulties of working directly with MPI on GPUs, and we demonstrate its performance, scalability, and novel features.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2024

Testing the Activation Analysis for Fusion in OpenMC

OpenMC is a community-developed Monte Carlo neutron and photon transport simulation code. It can perform fission simulations such as fixed-source, k-eigenvalue, and subcritical multiplication calculations on models built using either a constructive solid geometry or CAD representation. To explore the use of OpenMC for fusion activation analysis, a detailed model of the Fusion Neutronics Science Facility (FNSF) was first developed for comparisons against an existing SERPENT model. A 90-degree model of FNSF in Standard-Triangle-Language (STL) CAD format was converted to Constructive Solid Geometry (CSG) using each code's built-in functions, and the geometries were validated by ensuring no cells overlapped and no particles were lost during simulations. The neutron fluxes were calculated and compared for multiple components close to the plasma. The results show differences mostly below 1% in fluxes and averaged 8% for activity and decay heat. Here, the work described in this study tests the CAD-based geometry using the DagMC toolkit in OpenMC and compares the activation analysis of OpenMC to SERPENT code.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2026

Simulation of Divertor Performance in ST40 Under Dynamic Double-Null Plasmas

A power fraction model was implemented for the simultaneous prediction of 3-D surface temperature evolution at all four divertor targets in near-double-null (DN) tokamak configurations, which is especially important for compact high-field devices that may not have the ability to dissipate large amounts of power on the high-field side. Evaluating the power-sharing between the four divertor strike points in a disconnected DN configuration is important for understanding the overall power balance, as well as for optimizing the power exhaust performance and prolonging the survivability of the plasma facing components (PFCs). This power-sharing is typically evaluated in terms of the separation between the primary and secondary separatrices at the outboard midplane, $\textit {dR}_{\text {sep}}$. The Heat flux Engineering Analysis Toolkit (HEAT) is coupled with Brunner’s power fraction model to simulate the deposited heat flux and resultant temperature change on 3-D divertor targets in a dynamic DN (DDN) pulse operation in ST40, a high-field spherical tokamak. The simulation results showed that with DDN operation, the operation time has significantly increased compared with single-null geometry configurations.

ST40↗
DOE OSTI2023

Modeling and Rapid Prototyping of Integrated Transmission-Distribution OPF Formulations with PowerModelsITD.jl

Conventional electric power systems are composed of different unidirectional power flow stages of generation, transmission, and distribution, managed independently by transmission system and distribution system operators. However, as distribution systems increase in complexity due to the integration of distributed energy resources, coordination between transmission and distribution networks will be imperative for the optimal operation of the power grid. However, coupling models and formulations between transmission and distribution is non-trivial, in particular due to the common practice of modeling transmission systems as single-phase, and distribution systems as multi-conductor phase-unbalanced. To enable the rapid prototyping of power flow formulations, in particular in the modeling of the boundary conditions between these two seemingly incompatible data models, we introduce PowerModelsITD.jl, a free, open-source toolkit written in Julia for integrated transmission-distribution (ITD) optimization that leverages mature optimization libraries from the InfrastructureModels.jl-ecosystem. The primary objective of the proposed framework is to provide baseline implementations of steady-state ITD optimization problems, while providing a common platform for the evaluation of emerging formulations and optimization problems. In this work, we introduce the nonlinear formulations currently supported in PowerModelsITD.jl, which include AC-polar, AC-rectangular, current-voltage, and a linear network transportation model. Results are validated using combinations of IEEE transmission and distribution networks.

24 POWER TRANSMISSION AND DISTRIBUTION↗
DOE OSTI2017

BASTet: Shareable and Reproducible Analysis and Visualization of Mass Spectrometry Imaging Data via OpenMSI

Mass spectrometry imaging (MSI) is a transformative imaging method that supports the untargeted, quantitative measurement of the chemical composition and spatial heterogeneity of complex samples with broad applications in life sciences, bioenergy, and health. While MSI data can be routinely collected, its broad application is currently limited by the lack of easily accessible analysis methods that can process data of the size, volume, diversity, and complexity generated by MSI experiments. The development and application of cutting-edge analytical methods is a core driver in MSI research for new scientific discoveries, medical diagnostics, and commercial-innovation. However, the lack of means to share, apply, and reproduce analyses hinders the broad application, validation, and use of novel MSI analysis methods. To address this central challenge, we introduce the Berkeley Analysis and Storage Toolkit (BASTet), a novel framework for shareable and reproducible data analysis that supports standardized data and analysis interfaces, integrated data storage, data provenance, workflow management, and a broad set of integrated tools. Based on BASTet, we describe the extension of the OpenMSI mass spectrometry imaging science gateway to enable web-based sharing, reuse, analysis, and visualization of data analyses and derived data products. Here, we demonstrate the application of BASTet and OpenMSI in practice to identify and compare characteristic substructures in the mouse brain based on their chemical composition measured via MSI.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2021

Optimization and Augmentation for Data Parallel Contour Trees

Contour trees are used for topological data analysis in scientific visualization. While originally computed with serial algorithms, recent work has introduced a vector-parallel algorithm. Furthermore, this algorithm is relatively slow for fully augmented contour trees which are needed for many practical data analysis tasks. We therefore introduce a representation called the hyperstructure that enables efficient searches through the contour tree and use it to construct a fully augmented contour tree in data parallel, with performance on average 6 times faster than the state-of-the-art parallel algorithm in the TTK topological toolkit.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2022

SPEL: Software tool for Porting E3SM Land Model with OpenACC in a Function Unit Test Framework

Most high-end computers adopt hybrid architecture, porting a large-scale scientific code onto accelerators is necessary. The paper presents a generic method for porting large-scale scientific code onto accelerators using compiler directives within a modularized function unit test platform. We have implemented the method and designed a software tool (SPEL) to port the E3SM Land Model (ELM) onto the GPUs in the Summit computer. SPEL automatically generates GPU-ready test modules for all ELM functions, such as CanopyFlux, SoilTemperature, and EcosystemDynamics. SPEL breaks the ELM into a collection of standalone unit test programs for easy code verification and further performance improvement. We further optimize several ELM test modules with advanced techniques, including memory reduction, reconstructed parallel loops, and asynchronous GPU kernel launch. We hope our study will inspire new toolkit developments that expedite large-scale scientific code porting with compiler directives.

Schwartz, Peter↗
DOE OSTI2022

Novel Proposals for FAIR, Automated, Recommendable, and Robust Workflows

Lightning talks of the Workflows in Support of Large-Scale Science (WORKS) workshop are a venue where the workflow community (researchers, developers, and users) can discuss work in progress, emerging technologies and frameworks, and training and education materials. This paper summarizes the WORKS 2022 lightning talks, which cover five broad topics: data integrity of scientific workflows; a machine learning-based recommendation system; a Python toolkit for running dynamic ensembles of simulations; a cross-platform, high-performance computing utility for processing shell commands; and a meta(data) framework for reproducing hybrid workflows.

Abhinit, Ishan↗
DOE OSTI2021

Gene family expansions and transcriptome signatures uncover fungal adaptations to wood decay

Because they comprise some of the most efficient wood-decayers, Polyporales fungi impact carbon cycling in forest environment. Despite continuous discoveries on the enzymatic machinery involved in wood decomposition, the vision on their evolutionary adaptation to wood decay and genome diversity remains incomplete. We combined the genome sequence information from 50 Polyporales species, including 26 newly sequenced genomes and sought for genomic and functional adaptations to wood decay through the analysis of genome composition and transcriptome responses to different carbon sources. The genomes of Polyporales from different phylogenetic clades showed poor conservation in macrosynteny, indicative of genome rearrangements. We observed different gene family expansion/contraction histories for plant cell wall degrading enzymes in core polyporoids and phlebioids and captured expansions for genes involved in signalling and regulation in the lineages of white rotters. Furthermore, we identified conserved cupredoxins, thaumatin-like proteins and lytic polysaccharide monooxygenases with a yet uncharacterized appended module as new candidate players in wood decomposition. Given the current need for enzymatic toolkits dedicated to the transformation of renewable carbon sources, the observed genomic diversity among Polyporales strengthens the relevance of mining Polyporales biodiversity to understand the molecular mechanisms of wood decay.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

An automated workflow that generates atom mappings for large‐scale metabolic models and its application to Arabidopsis thaliana

SUMMARY Quantification of reaction fluxes of metabolic networks can help us understand how the integration of different metabolic pathways determines cellular functions. Yet, intracellular fluxes cannot be measured directly but are estimated with metabolic flux analysis (MFA), which relies on the patterns of isotope labeling of metabolites in the network. The application of MFA also requires a stoichiometric model with atom mappings that are currently not available for the majority of large‐scale metabolic network models, particularly of plants. While automated approaches such as the Reaction Decoder Toolkit (RDT) can produce atom mappings for individual reactions, tracing the flow of individual atoms of the entire reactions across a metabolic model remains challenging. Here we establish an automated workflow to obtain reliable atom mappings for large‐scale metabolic models by refining the outcome of RDT, and apply the workflow to metabolic models of Arabidopsis thaliana . We demonstrate the accuracy of RDT through a comparative analysis with atom mappings from a large database of biochemical reactions, MetaCyc. We further show the utility of our automated workflow by simulating 15 N isotope enrichment and identifying nitrogen (N)‐containing metabolites which show enrichment patterns that are informative for flux estimation in future 15 N‐MFA studies of A. thaliana . The automated workflow established in this study can be readily expanded to other species for which metabolic models have been established and the resulting atom mappings will facilitate MFA and graph‐theoretic structural analyses with large‐scale metabolic networks.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Turbo‐charging crop improvement: harnessing multiplex editing for polygenic trait engineering and beyond

Multiplex CRISPR editing has emerged as a transformative platform for plant genome engineering, enabling the simultaneous targeting of multiple genes, regulatory elements, or chromosomal regions. This approach is effective for dissecting gene family functions, addressing genetic redundancy, engineering polygenic traits, and accelerating trait stacking and de novo domestication. Its applications now extend beyond standard gene knockouts to include epigenetic and transcriptional regulation, chromosomal engineering, and transgene‐free editing. These capabilities are advancing crop improvement not only in annual species but also in more complex systems such as polyploids, undomesticated wild relatives, and species with long generation times. At the same time, multiplex editing presents technical challenges, including complex construct design and the need for robust, scalable mutation detection. We discuss current toolkits and recent innovations in vector architecture, such as promoter and scaffold engineering, that streamline workflows and enhance editing efficiency. High‐throughput sequencing technologies, including long‐read platforms, are improving the resolution of complex editing outcomes such as structural rearrangements—often missed by standard genotyping—when targeting repetitive or tandemly spaced loci. To fully realize the potential of multiplex genome engineering, there is growing demand for user‐friendly, synthetic biology‐compatible, and scalable computational workflows for gRNA design, construct assembly, and mutation analysis. Experimentally validated inducible or tissue‐specific promoters are also highly desirable for achieving spatiotemporal control. As these tools continue to evolve, multiplex CRISPR editing is poised to become a foundational technology of next‐generation crop improvement to address challenges in agriculture, sustainability, and climate resilience.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2017

Combining RAVEN, RELAP5-3D, and PHISICS for Fuel Cycle and Core Design Analysis for New Cladding Criteria

The Nuclear Regulatory Commission (NRC) has considered revision of 10 CFR 50.46C rule to account for the effects of burn-up rate in future analysis of reactor accident scenarios so that safety margins may evolve with the operation and reloading of the reactor as dynamic limits. In order to find these limiting conditions, both cladding oxidation and maximum temperature must be cast as functions of fuel exposure. It is computationally intensive to run a plant model through a long duration operational transient to the time of fuel reload, and this must be repeated for each reload until the time of the accident scenario. Moreover, fuel reload patterns may differ in many ways so that calculations with many different core configurations must be considered. To perform such new analyses in a reasonable amount of computational time with good accuracy, Idaho National Laboratory (INL) has developed new multi-physics tools by combining existing codes and adding new capabilities. The Parallel Highly Innovative Simulation INL Code System (PHISICS) toolkit for neutronic and reactor physics is coupled with the Reactor Excursion and Leak Analysis Program (RELAP5-3D) for the Loss of Coolant Accident (LOCA) analysis and RAVEN for the Probabilistic Risk Assessment (PRA) and margin characterization analysis. Expansion of code capability was also necessary. For RELAP5-3D to process a single sequence of cores in a continuous run required modification of RELAP5-3D to restart a sequence of input decks, each with a slightly modified neutronics model or thermal-hydraulic flow region and culminating in an accident scenario. A new multi-deck input processing capability was developed and verified for this analysis. In conclusion, the combined RAVEN/PHISICS/RELAP5-3D tool is used to analyze a typical Pressurized Water Reactor (PWR).

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗
DOE OSTI2025

Black-box optimization of CT acquisition and reconstruction parameters: a reinforcement learning approach

Protocol optimization is critical in Computed Tomography (CT) for achieving desired diagnostic image quality while minimizing radiation dose. Due to the inter-effect of influencing CT parameters, traditional optimization methods rely on the testing of exhaustive combinations of these parameters. This poses a notable limitation due to the impracticality of exhaustive parameter testing. This study introduces a novel methodology leveraging Virtual Imaging Trials (VITs) and reinforcement learning to more efficiently optimize CT protocols. Computational phantoms with liver lesions were imaged using a validated CT simulator and reconstructed with a novel CT reconstruction Toolkit. The optimization parameter space included tube voltage, tube current, reconstruction kernel, slice thickness, and pixel size. The optimization process was done using a Proximal Policy Optimization (PPO) agent which was trained to maximize the Detectability Index (d’) of the liver lesion for each reconstructed image. Results showed that our reinforcement learning approach found the absolute maximum d’ across the test cases while requiring 79.7% fewer steps compared to an exhaustive search, demonstrating both accuracy and computational efficiency, offering a efficient and robust framework for CT protocol optimization. The flexibility of the proposed technique allows for use of varying image quality metrics as the objective metric to maximize for. Our findings highlight the advantages of combining VIT and reinforcement learning for CT protocol management.

Fenwick, David [Duke University Medical Center]↗