Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “motion”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,297 records · Page 72
All sourcesNASA NTRSDOE OSTI
DOE OSTI2015

A nonlinear piezoelectric energy harvester for various mechanical motions

This study presents a nonlinear piezoelectric energy harvester with intent to scavenge energy from diverse mechanical motions. The harvester consists of four piezoelectric cantilever beams, a cylindrical track, and a ferromagnetic ball, with magnets integrated to introduce the magnetic coupling between the ball and the beams. The experimental results demonstrate that the harvester is able to collect energy from various directions of vibrations. For the vibrations perpendicular to the ground, the maximum peak voltage is increased by 3.2 V and the bandwidth of the voltage above 4 V is increased by more than 4 Hz compared to the results obtained when using a conventional design. For the vibrations along the horizontal direction, the frequency up-conversion is realized through the magnetic coupling. Moreover, the proposed design can harvest energy from the sway motion around different directions on the horizontal plane. Harvesting energy from the rotation motion is also achieved with an operating bandwidth of approximately 6 Hz.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2015

Homoclinic behaviors and chaotic motions of double layered viscoelastic nanoplates based on nonlocal theory and extended Melnikov method

The nonlinear dynamical equations are established for the double layered viscoelastic nanoplates (DLNP) subjected to in-plane excitation based on the nonlocal theory and von Kármán large deformation theory. The extended high dimensional homoclinic Melnikov method is employed to study the homoclinic phenomena and chaotic motions for the parametrically excited DLNP system. The criteria for the homoclinic transverse intersection for both the asynchronous and synchronous buckling cases are proposed. Lyapunov exponents and phase portraits are obtained to verify the Melnikov-type analysis. The influences of structural parameters on the transverse homoclinic orbits and homoclinic bifurcation sets are discussed for the two buckling cases. Some novel phenomena are observed in the investigation. It should be noticed that the nonlocal effect on the homoclinic behaviors and chaotic motions is quite remarkable. Hence, the small scale effect should be taken into account for homoclinic and chaotic analysis for nanostructures. It is significant that the nonlocal effect on the homoclinic phenomena for the asynchronous buckling case is quite different from that for the synchronous buckling case. Moreover, due to the van der Walls interaction between the layers, the nonlocal effect on the homoclinic behaviors and chaotic motions for high order mode is rather tiny under the asynchronous buckling condition.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2015

Relativistic electron motion in cylindrical waveguide with strong guiding magnetic field and high power microwave

In O-type high power microwave (HPM) devices, the annular relativistic electron beam is constrained by a strong guiding magnetic field and propagates through an interaction region to generate HPM. Some papers believe that the E × B drift of electrons may lead to beam breakup. This paper simplifies the interaction region with a smooth cylindrical waveguide to research the radial motion of electrons under conditions of strong guiding magnetic field and TM{sub 01} mode HPM. The single-particle trajectory shows that the radial electron motion presents the characteristic of radial guiding-center drift carrying cyclotron motion. The radial guiding-center drift is spatially periodic and is dominated by the polarization drift, not the E × B drift. Furthermore, the self fields of the beam space charge can provide a radial force which may pull electrons outward to some extent but will not affect the radial polarization drift. Despite the radial drift, the strong guiding magnetic field limits the drift amplitude to a small value and prevents beam breakup from happening due to this cause.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2015

The stability of steady motion of magnetic domain wall: Role of higher-order spin-orbit torques

The steady motion of magnetic domain wall driven by spin-orbit torques is investigated analytically in the heavy/ferromagnetic metal nanowires for three cases with a current transverse to the in-plane and perpendicular easy axis, and along the in-plane easy axis. By the stability analysis of Walker wall profile, we find that if including the higher-order spin-orbit torques, the Walker breakdown can be avoided in some parameter regions of spin-orbit torques with a current transverse to or along the in-plane easy axis. However, in the case of perpendicular anisotropy, even considering the higher-order spin-orbit torques, the velocity of domain wall cannot be efficiently enhanced by the current. Furthermore, the direction of wall motion is dependent on the configuration and chirality of domain wall with a current along the in-plane easy axis or transverse to the perpendicular one. Especially, the direction of motion can be controlled by the initial chirality of domain wall. So, if only involving the spin-orbit mechanism, it is preferable to adopt the scheme of a current along the in-plane easy axis for enhancing the velocity and controlling the direction of domain wall.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2016

Internal twisting motion dependent conductance of an aperiodic DNA molecule

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from a base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2016

Evidence of a rolling motion of a microparticle on a silicon wafer in a liquid environment

The interaction of micro- and nanometer-sized particles with surfaces plays a crucial role when small-scale structures are built in a bottom-up approach or structured surfaces are cleaned in the semiconductor industry. For a reliable quantification of the interaction between individual particles and a specific surface, however, the motion type of the particle must be known. We developed an approach to unambiguously distinguish between sliding and rolling particles. To this end, fluorescent particles were partially bleached in a confocal laser scanning microscope to tailor an optical inhomogeneity, which allowed for the identification of the characteristic motion pattern. For the manipulation, the water flow generated by a fast moving cantilever-tip of an atomic force microscope enabled the contactless pushing of the particle. We thus experimentally evidenced a rolling motion of a micrometer-sized particle directly with a fluorescence microscope. A similar approach could help to discriminate between rolling and sliding particles in liquid flows of microfluidic systems.

42 ENGINEERING↗
DOE OSTI2016

A separation of antiferromagnetic spin motion modes in the training effect of exchange biased Co/CoO film with in-plane anisotropy

The motion of antiferromagnetic interfacial spins is investigated through the temperature evolution of training effect in a Co/CoO film with in-plane biaxial anisotropy. Significant differences in the training effect and its temperature dependence are observed in the magnetic easy axis and hard axis (HA) and ascribed to the different motion modes of antiferromagnetic interfacial spins, the collective spin cluster rotation (CSR) and the single spin reversal (SSR), caused by different magnetization reversal modes of ferromagnetic layer. These motion modes of antiferromagnetic spins are successfully separated using a combination of an exponential function and a classic n{sup −1/2} function. A larger CSR to SSR ratio and a shorter lifetime of CSR found in the HA indicates that the domain rotation in the ferromagnetic layer tends to activate and accelerate a CSR mode in the antiferromagnetic spins.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2016

Vacuum arc cathode spot motion in oblique magnetic fields: An interpretation of the Robson experiment

A model was developed of vacuum arc cathode spot motion in a magnetic field that obliquely intercepts the cathode surface. The model takes into account a force under an electric field caused by retrograde spot motion across the normal component of the magnetic field, producing a drift velocity component in the direction of the acute angle between the magnetic field and the cathode surface. The relationship between velocity of the retrograde direction and drift velocity of the cathode spot motion to the acute angle was developed. The dependencies of the drift angle θ on the acute angle φ, magnetic field strength B, and arc current I were calculated. It was found that the calculated θ increased with φ, B, and I in accordance with Robson's measurements.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2017

Model of vertical plasma motion during the current quench

Tokamak disruptions impair plasma position control, which allows the plasma column to move and hit the wall. These detrimental events enhance thermal and mechanical loads due to halo currents and runaway electron losses. Their fundamental understanding and prevention is one of the high-priority items for ITER. As commonly observed in experiments (see e.g., Refs. 1 and 2), the disruptive plasma tends to move vertically, and the timescale of this motion is rather resistive than Alfvenic. These observations suggest that the plasma column is nearly force-free during its vertical motion. In fact, the force-free constraint is already implemented in disruption simulators (see Ref. 3). In this work, we consider a geometrically simple system that mimics the tokamak plasma surrounded by the conducting structures. Using this model, we highlight the underlying mechanism of the vertical displacement events during the current quench phase of plasma disruption. The same geometrical simplification was recently employed in Ref. 8 but without taking advantage of the force-free approximation. We find that the force-free ansatz makes the description more transparent by immediate elimination of the fast Alfvenic time-scale. This helps to reveal possible violation of ideal MHD stability during slow resistive motion of the plasma.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2019

Extracting collective motions underlying nucleosome dynamics via nonlinear manifold learning

The identification of effective collective variables remains a challenge in molecular simulations of complex systems. Here, we use a nonlinear manifold learning technique known as the diffusion map to extract key dynamical motions from a complex biomolecular system known as the nucleosome: a DNA-protein complex consisting of a DNA segment wrapped around a disc-shaped group of eight histone proteins. We show that without any a priori information, diffusion maps can identify and extract meaningful collective variables that characterize the motion of the nucleosome complex. We find excellent agreement between the collective variables identified by the diffusion map and those obtained manually using a free energy-based analysis. Notably, diffusion maps are shown to also identify subtle features of nucleosome dynamics that did not appear in those manually specified collective variables. For example, diffusion maps identify the importance of looped conformations in which DNA bulges away from the histone complex that are important for the motion of DNA around the nucleosome. As a result, this work demonstrates that diffusion maps can be a promising tool for analyzing very large molecular systems and for identifying their characteristic slow modes.

36 MATERIALS SCIENCE↗
DOE OSTI2020

Quantitative probing of the fast particle motion during the solidification of battery electrodes

Synchrotron x-ray tomography represents one of the most powerful imaging techniques that can visualize the three-dimensional microstructural complexity with a high spatial resolution. To date, however, the temporal resolution of this technique has been handicapped by the intrinsic limitations in the data acquisition speed and the lack of a suitable data processing method. The present study aims to fundamentally resolve this challenge by implementing a data analysis method that is based on differentiating discrete tomography reconstruction from a continuous scan reconstruction. With this methodological development, we capture and quantify the particle motion during the solidification of battery electrodes and reveal the statistics of the dynamically evolving motion in the drying process, which has been challenging to resolve. We discover that the particle motion exhibits a strong dependence on its geometric location within a drying electrode. Our results also imply that the final electrode quality can be controlled by balancing the solvent evaporation rate and the particle mobility in the region close to the drying surface.

25 ENERGY STORAGE↗
DOE OSTI2017

On the possibility of observing chaotic motion of cold atoms in rigid optical lattices

The possibility of experimental observation of chaotic motion of cold atoms in a one-dimensional rigid optical lattice without any modulation of its parameters and additional impact is demonstrated theoretically and numerically. This effect of deterministic chaos arises near the optical resonance due to the nonlinear coupling of electronic and mechanical degrees of freedom in the atom. In a certain range of resonance detunings, at each crossing of the lattice-forming standing wave node by the atom, the atomic dipole moment changes pseudorandomly in a step-like manner, accompanied by an appropriate change in the atom momentum. This leads to the effect of chaotic wandering of atoms, possessing the properties of the classical deterministic chaos, namely, to the exponential sensitivity of atomic trajectories to small variations of the initial conditions and/or the control parameters. With time, part of atoms from the initial cloud changes the direction of their motion to the opposite one, which can be detected in a real experiment. Numerical experiments with lithium atoms with the spontaneous emission taken into account show that by varying the laser radiation intensity (normalised detuning of resonance) in the rigid optical lattice, one can implement the transition from the regular regime of the atomic motion to the chaotic wandering in a real experiment. (paper)

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2012

Classification of singularities in the problem of motion of the Kovalevskaya top in a double force field

The problem of motion of the Kovalevskaya top in a double force field is investigated (the integrable case of A.G. Reyman and M.A. Semenov-Tian-Shansky without a gyrostatic momentum). It is a completely integrable Hamiltonian system with three degrees of freedom not reducible to a family of systems with two degrees of freedom. The critical set of the integral map is studied. The critical subsystems and bifurcation diagrams are described. The classification of all nondegenerate critical points is given. The set of these points consists of equilibria (nondegenerate singularities of rank 0), of singular periodic motions (nondegenerate singularities of rank 1), and also of critical two-frequency motions (nondegenerate singularities of rank 2). Bibliography: 32 titles.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2012

SUCCESSIVE SOLAR ERUPTIONS TRIGGERED BY THE COLLISION OF TWO SMALL SUNSPOTS WITH OPPOSITE POLARITIES AND MOTIONAL DIRECTIONS

We present a study of the two successive M-class flares associated with two coronal mass ejections (CMEs) triggered by the collision of two small sunspots with opposite magnetic polarities and motional directions in NOAA active region (AR) 10484 on 2003 October 22. From the evolution of this AR in the TRACE white-light images and 96 minute line-of-sight magnetograms observed by the Michelson Doppler Imager on board SOHO, a large sunspot and a small sunspot with negative polarity rotated clockwise about 33 Degree-Sign and 18 Degree-Sign , respectively, from the northeast of a quiescent sunspot with negative polarity to the southeast from 15:00 UT on October 21 to 16:24 UT on October 23. During the process of their motion, the small sunspot with negative polarity collided with the small sunspot with positive polarity and opposite motional direction. In the collision, this AR produced two successive M-class flares and CMEs according to the observations of GOES and the Large Angle and Spectrometric Coronagraph. By analyzing the magnetic fields at polarity inversion lines (PILs) between the two small sunspot, it is found that a sudden squeeze occurred near the onset of the two M-class flares and then recovered itself after the flares. We ruled out the emergence of the magnetic fields near the PIL. According to the brightenings in TRACE 1600 A and the hard X-ray sources of the RHESSI of two M-class flares, we found that the locations of the two flares are almost situated in the same location at the PIL between the two small sunspots. We suggest that the sudden squeeze between the opposite magnetic polarities is caused by the pressure of the collision of the two small sunspots and resulted in the magnetic reconnection. These results could contribute to understanding the mechanism of flares and CMEs.

79 ASTRONOMY AND ASTROPHYSICS↗
DOE OSTI2015

Radio emission and orbital motion from the close-encounter star–brown dwarf binary WISE J072003.20–084651.2

We report the detection of radio emission and orbital motion from the nearby star–brown dwarf binary WISE J072003.20–084651.2AB. Radio observations across the 4.5–6.5 GHz band with the Very Large Array identify at the position of the system quiescent emission with a flux density of 15 ± 3 μJy, and a highly polarized radio source that underwent a 2–3 minute burst with peak flux density 300 ± 90 μJy. The latter emission is likely a low-level magnetic flare similar to optical flares previously observed for this source. No outbursts were detected in separate narrow-band Hα monitoring observations. We report new high-resolution imaging and spectroscopic observations that confirm the presence of a co-moving T5.5 secondary and provide the first indications of three-dimensional orbital motion. We used these data to revise our estimates for the orbital period (4.1{sub −1.3}{sup +2.7} year) and tightly constrain the orbital inclination to be nearly edge-on (93.°6{sup +1.°6}{sub −1.°4}), although robust measures of the component and system masses will require further monitoring. The inferred orbital motion does not change the high likelihood that this radio-emitting very low-mass binary made a close pass to the Sun in the past 100 kyr.

79 ASTRONOMY AND ASTROPHYSICS↗
DOE OSTI2012

DYNAMICS OF THE SOLAR MAGNETIC BRIGHT POINTS DERIVED FROM THEIR HORIZONTAL MOTIONS

The subarcsecond bright points (BPs) associated with the small-scale magnetic fields in the lower solar atmosphere are advected by the evolution of the photospheric granules. We measure various quantities related to the horizontal motions of the BPs observed in two wavelengths, including the velocity autocorrelation function. A 1 hr time sequence of wideband H{alpha} observations conducted at the Swedish 1 m Solar Telescope (SST) and a 4 hr Hinode G-band time sequence observed with the Solar Optical Telescope are used in this work. We follow 97 SST and 212 Hinode BPs with 3800 and 1950 individual velocity measurements, respectively. For its high cadence of 5 s as compared to 30 s for Hinode data, we emphasize more the results from SST data. The BP positional uncertainty achieved by SST is as low as 3 km. The position errors contribute 0.75 km{sup 2} s{sup -2} to the variance of the observed velocities. The raw and corrected velocity measurements in both directions, i.e., (v{sub x} , v{sub y} ), have Gaussian distributions with standard deviations of (1.32, 1.22) and (1.00, 0.86) km s{sup -1}, respectively. The BP motions have correlation times of about 22-30 s. We construct the power spectrum of the horizontal motions as a function of frequency, a quantity that is useful and relevant to the studies of generation of Alfven waves. Photospheric turbulent diffusion at timescales less than 200 s is found to satisfy a power law with an index of 1.59.

79 ASTRONOMY AND ASTROPHYSICS↗
DOE OSTI2012

WAVES AS THE SOURCE OF APPARENT TWISTING MOTIONS IN SUNSPOT PENUMBRAE

The motion of dark striations across bright filaments in a sunspot penumbra has become an important new diagnostic of convective gas flows in penumbral filaments. The nature of these striations has, however, remained unclear. Here, we present an analysis of small-scale motions in penumbral filaments in both simulations and observations. The simulations, when viewed from above, show fine structure with dark lanes running outward from the dark core of the penumbral filaments. The dark lanes either occur preferentially on one side or alternate between both sides of the filament. We identify this fine structure with transverse (kink) oscillations of the filament, corresponding to a sideways swaying of the filament. These oscillations have periods in the range of 5-7 minutes and propagate outward and downward along the filament. Similar features are found in observed G-band intensity time series of penumbral filaments in a sunspot located near disk center obtained by the Broadband Filter Imager on board the Hinode. We also find that some filaments show dark striations moving to both sides of the filaments. Based on the agreement between simulations and observations we conclude that the motions of these striations are caused by transverse oscillations of the underlying bright filaments.

79 ASTRONOMY AND ASTROPHYSICS↗
DOE OSTI2012

LARGE-SCALE MOTIONS IN THE PERSEUS GALAXY CLUSTER

By combining large-scale mosaics of ROSAT PSPC, XMM-Newton, and Suzaku X-ray observations, we present evidence for large-scale motions in the intracluster medium of the nearby, X-ray bright Perseus Cluster. These motions are suggested by several alternating and interleaved X-ray bright, low-temperature, low-entropy arcs located along the east-west axis, at radii ranging from {approx}10 kpc to over a Mpc. Thermodynamic features qualitatively similar to these have previously been observed in the centers of cool-core clusters, and were successfully modeled as a consequence of the gas sloshing/swirling motions induced by minor mergers. Our observations indicate that such sloshing/swirling can extend out to larger radii than previously thought, on scales approaching the virial radius.

79 ASTRONOMY AND ASTROPHYSICS↗