Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “Core Analysis”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,225 records · Page 68
All sourcesNASA NTRSDOE OSTI
DOE OSTI2022

PV Reference Cells for Outdoor Use: Comparison of First-Year Field Measurements

Reference cells are widely used in the photovoltaic (PV) industry to measure irradiance. For field applications and outdoor use, a variety of products are on the market, and they are often perceived as low-cost alternatives to thermopile pyranometers. But reference cell characteristics, such as directional and spectral response, fundamentally differ from pyranometers, and measurements made by the former cannot be substituted for or directly compared with the latter. The National Renewable Energy Laboratory's (NREL's) Solar Radiation Research Laboratory is currently in a multiyear effort to develop guidance and recommendations for the design and use of outdoor reference cells, with a view to reducing inconsistencies and measurement uncertainty. The core of this effort is the long-term deployment of multiple products from different manufacturers that are mounted at a fixed tilt, on a single-axis tracker, and on a dual-axis tracker. This report provides an analysis of the data collected during the first year of operation at the NREL location. An overall assessment is made by comparing the total energy measured by each instrument to the other instruments having the same orientation. These totals are calculated for three different scenarios: (1) using the factory calibration factors, (2) using the previously determined NREL Cell Lab calibration factors, and (3) using the newly determined field calibration factors derived from the recorded measurements. Because the true or correct measurement values are unknown, pair-wise comparisons are made. The results show that the difference between the highest and lowest measured energy can exceed 3% when using the factory calibration factors. Consistency among instruments improves when Cell Lab calibrations are used, and it further improves when using field calibration factors.

14 SOLAR ENERGY↗
DOE OSTI2024

Benchmark Calculation for Surry Unit 1 Cycles 1-3 Using the SCALE 6.3/Polaris–PARCS v3.4.2 Code Package

The benchmark calculations were performed for Surry Unit 1 cycles 1–3 to validate the SCALE 6.3/Polaris–Purdue Advanced Reactor Core Simulator (PARCS) v3.4.2 with the ENDF/B–VII.1 56–group library by comparing the simulated results with the measured data. The benchmark results will be used to evaluate uncertainties of the SCALE/Polaris–PARCS code package for pressurized water reactor physics analysis for key nuclear parameters such as reactivity, control bank worth, temperature coefficients, and pin and assembly power peaking factors. This report details plant and fuel design specifications and input data for SCALE/Polaris, GenPMAXS, and PARCS. Additional details are provided for the input and output files produced for the benchmark calculations. The benchmark results were summarized such that they can be used in evaluating uncertainties with other benchmark results for key nuclear parameters.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2024

Investigation of core transport changes in DIII-D discharges with off-axis T e profile peaks

Abstract DIII-D discharges that transition to H-mode solely with off-axis electron cyclotron heating (ECH) often exhibit strong off-axis peaking of electron temperature profiles at the heating location. Electron heat transport properties near these off-axis temperature peaks have been studied using modulated ECH. The Fourier analyzed electron temperature data have been used to infer electron thermal diffusivity. Comparisons with numerical solutions of the time-dependent electron thermal equation find that the data are consistent with a narrow region with electron diffusivity χ e an order of magnitude lower than the average value across the plasma, suggesting an electron internal transport barrier (ITB) near the ECH heating location. Detailed profile analysis and equilibrium reconstructions suggest that the formation of these ITBs are correlated with off-axis values of the safety factor q being near 1. Furthermore, the ECH driven H-mode discharges demonstrate more rapid electron heating rate near the ECH deposition location than L-mode discharges with higher auxiliary ECH heating power. Additional modeling attributes this difference to the modification of electron heat transport in the core at the L-H transition, which also sustains the off-axis electron temperature peaks.

Physics↗
DOE OSTI2026

Data for Spatial Analysis of Cell Patterning to Aid Genetic and Phenotypic Understanding of Grass Stomatal Density: A Case Study in Maize

Biological processes involve complex hierarchies where composite traits result from multiple component traits. However, holistically understanding of how sets of component traits interact to underpin genotype-to-phenotype relationships is generally lacking. Stomatal density (SD) is a tractable model system for exploring how high-throughput phenotyping (HTP) data could be exploited by a new spatial analysis approach to better understand a developmentally and functionally important trait. SD is a composite trait, resulting from various components related to cell identity and size, which are themselves governed by a series of spatio-developmental processes. Data from 192 recombinant inbred lines of maize [Zea mays (L.)] were analyzed by a new stomatal patterning phenotype (SPP) to (1) describe the average spatial probability distribution of the nearest neighboring stomata; (2) derive a core set of component traits related to cell size, cell packing, and positional probabilities; (3) build a structural equation model of component traits underlying SD; and (4) identify stomatal patterning quantitative trait loci (QTL). The core set of SPP-derived traits explained 74% of the variation in SD. Analyzing SPP component traits allowed some loci previously identified as generic SD QTL to be recognized as specific to lateral versus longitudinal elements of stomatal patterning. Therefore, this study highlights how novel insights can be gained by decomposing a composite trait (e.g., SD) into a set of component traits that were present in HTP data but not previously exploited.

AI/ML↗
DOE OSTI2024

Coupled SAM/Griffin Model of a Reference Fluoride-Salt-Cooled High-Temperature Reactor for Multi-Physics Simulations

A multi-physics coupled simulation model of a reference pebble bed fluoride-salt-cooled high-temperature reactor (PB-FHR) has been developed with SAM and Griffin computer codes for transient safety analysis. The reference problem of a prototypical reactor design serves as the foundation for the U.S. NRC (Nuclear Regulatory Commission) to verify the adequacy of computer codes and evaluation models for specific reactor types. In this work, the previously developed SAM model for PB-FHR primary loop has been updated for the coupled simulation. The updated SAM PB-FHR model includes a 2-D axial symmetric core region and external core components in 0-D/1-D. In addition to the primary loop, a detailed model of the RCCS (reactor cavity cooling system) is added. The 2-D and 1-D domains are tightly coupled using the single-solve approach developed in SAM. In the pebble bed region, the SAM multiscale explicit pebble model is applied to calculate the pebble and TRISO fuel kernel temperatures. The Griffin model used in this work is based on a model developed at Idaho National Laboratory in collaboration with the U.S. NRC. The Griffin neutronics model and SAM thermal hydraulics model is coupled with the Comprehensive Reactor Analysis Bundle (CRAB or alternately BlueCRAB) application. Both steady-state and transient scenarios are simulated to demonstrate the model's suitability for multi-physics simulations of PB-FHR transients.

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗
DOE OSTI2022

Nuclear data uncertainty propagation applied to the versatile test reactor conceptual design

We report the Versatile Test Reactor (VTR) currently under development is a 300 MWth sodium-cooled fast reactor (SFR) fueled with ternary metal alloy fuel, which aims to accelerate the testing of advanced nuclear fuels, materials, instrumentation, and sensors in high flux environments that are necessary to license the next generation of advanced reactor concepts. To support the VTR design process, uncertainties associated with the nuclear data has been propagated through the reactor core neutronics calculation to global parameters of interest, such as the core multiplication factor, kinetic parameters, and various reactivity feedback coefficients, following the sensitivity based uncertainty propagation approach. By folding the sensitivity coefficients, separately computed by the generalized perturbation theory code PERSENT and Monte Carlo code Serpent 2, with the variance-covariance matrices from COMMARA-2.0, we obtain the reaction-wise, isotope-wise, and overall uncertainties for each response of interest due to nuclear data uncertainty. With Serpent 2, the statistical error of the uncertainty is obtained by propagating the statistical error of the sensitivity coefficients through the same process using a newly developed uncertainty propagation method. From both codes, the overall top uncertainty contributors are found to be the cross section of Fe-56 elastic scattering, Na-23 elastic scattering, and U 238 inelastic scattering. The large contributions of the Fe-56 elastic scattering cross sections to global parameters are due to its relatively large relative uncertainty of 5–10% in nuclear data and the large volume of Fe-containing reflector assemblies in the fairly compact VTR core design. Both codes agreed well for the overall uncertainty estimates of all responses of interest, except the delayed neutron fraction, prompt neutron generation time, and the coolant density feedback coefficient, where Serpent 2 yielded a much larger value than PERSENT due to the large statistical error of sensitivity coefficients. The calculated uncertainties are also compared to those associated with other SFR cores. Another outcome of this study is a variance-covariance matrix of reactivity coefficients, which can be used in the subsequent uncertainty propagation to the system level to investigate the impact of identified uncertainties on system responses in the safety analysis.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2023

Hydrostatic and Non‐Hydrostatic Baroclinic Instability in the Dynamical Core of the DOE Global Climate Model

Abstract The dynamical core of the Department of Energy global climate model is used to understand the role of non‐hydrostatic dynamics in the simulation of dry and moist baroclinic waves. To reduce computational cost, the Diabatic Acceleration and REscaling approach is adopted. Scale analysis and numerical simulations suggest that the model solution is not distorted by the change of spherical metric terms due to the change of Earth radius, neither are the inter‐scale interactions strongly altered as indicated by the analysis of spectral flux. Compared with hydrostatic simulations, the onset of baroclinic instability is delayed under non‐hydrostatic dynamics as the associated weaker vertical motions tend to increase the critical wavelength and narrow the range of waves that can be baroclinically unstable. During the development of baroclinic waves, non‐hydrostatic dynamics tends to induce vertical motions in the upper troposphere, accelerating the eastward propagation of upper‐level ridges through their impact on local vorticity tendency. These processes reduce the westward tilt of the vertical ridge axes and suppress the conversion of mean flow available potential energy to eddy kinetic energy, leading to weaker baroclinic eddies than in hydrostatic simulations. The contrasts between hydrostatic and non‐hydrostatic settings hold in supplemental experiments that vary the background flow Rossby number, the amount of water vapor content and vertical resolution. We also find that mesoscale and smaller‐scale activities can be considerably under‐represented when the vertical resolution is limited to that typically used in global climate models.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2021

57Fe Mössbauer isomer shift of pure iron and iron oxides at high pressure—An experimental and theoretical study

The 57Fe isomer shift (IS) of pure iron has been measured up to 100 GPa using synchrotron Mössbauer spectroscopy in the time domain. Apart from the expected discontinuity due to the α→ε structural and spin transitions, the IS decreases monotonically with increasing pressure. The absolute shifts were reproduced without semi-empirical calibrations by periodic density functional calculations employing extensive localized basis sets with several common density functionals. However, the best numerical agreement is obtained with the B1WC hybrid functional. Extension of the calculations to 350 GPa, a pressure corresponding to the Earth’s inner core, predicted the IS range of 0.00 to -0.85 mm/s, covering the span from Fe(0) to Fe(VI) compounds measured at ambient pressure. The calculations also reproduced the pressure trend from polymorphs of prototypical iron oxide minerals, FeO and Fe2O3. Analysis of the electronic structure shows a strong donation of electrons from oxygen to iron at high pressure. The assignment of formal oxidation to the Fe atom becomes ambiguous under this condition.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2025

16 O + 16 O fusion at sub-coulomb energies

A simple optical model (OPM) method using non-monotonic (NM) potentials characterized by a repulsive core from the microscopic theory of the Pauli-led energy-density functional (EDF) has been developed to investigate the 16 O + 16 O fusion at sub-Coulomb energies relevant to the oxygen burning. Here, the study involves the analysis of the experimental fusion cross-section (FCS) data in energy range 6.92 ≤ E cm ≤ 13.83 MeV, which includes the Coulomb barrier region E cm = 10.0–11.92 MeV. Apart from an excellent description of the existing FCS data in the studied energy range, the associated hindrance, characterized by the S-factor reaching a maximum and then gradually falling off at lower energies, so far suggested empirically for the system, is reproduced down to 4 MeV for the first time in the simple OPM. An S-factor maximum of S 0 = 3.15 × 10 25 MeV.b at E 0 = 7.14 MeV is observed with T ≃ 2.6 GK, which conforms to the values reported for quiescent and explosive burning. Our reaction rate, deduced from the NM potential, compares well with the Caughlan and Fowler data. Dominant partial waves implicit in the observed maximum S-factor in the studied Gamow range are also explored. Our present findings, with the success of NM potentials, suggest that the nucleus–nucleus potential is non-monotonic.

16O+16O↗
DOE OSTI2024

Toward a Holistic Performance Evaluation of Large Language Models Across Diverse AI Accelerators

Artificial intelligence (AI) methods have become critical in scientific applications to help accelerate scientific discovery. Large language models (LLMs) are being considered a promising approach to address some challenging problems because of their superior generalization capabilities across domains. The effectiveness of the models and the accuracy of the applications are contingent upon their efficient execution on the underlying hardware infrastructure. Specialized Al accelerator hardware systems have recently become available for accelerating Al applications. However, the comparative performance of these AI accelerators on large language models has not been previously studied. In this paper, we systematically study LLMs on multiple AI accelerators and GPUs and evaluate their performance characteristics for these models. We evaluate these systems with (i) a micro-benchmark using a core transformer block, (ii) a GPT-2 model, and (iii) an 1,I,M-driven science use case, GenSLM. We present our findings and analyses of the models' performance to better understand the intrinsic capabilities of AI accelerators. Furthermore, our analysis takes into account key factors such as sequence lengths, scaling behavior, and sensitivity to gradient accumulation steps.

Emani, Murali↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Chemical significance of x-ray photoelectron spectroscopy binding energy shifts: A Perspective

The principal intent of this Perspective is to review the mechanisms that are responsible for the shifts of binding energies, ΔBE, observed in x-ray photoelectron spectroscopy (XPS) measurements and so to relate the shifts to the electronic structure and the chemical bonding in the systems studied. To achieve this goal, several theoretical considerations are necessary beyond just the calculation of XPS BEs. Though briefly discussed here, we are not primarily interested in absolute values of BE or quantitation using relative intensities. Within the molecular orbital (MO) theory framework, it is shown that the analysis of orbital properties is critical for the correct interpretation of XPS. In particular, rigorous definitions are given for the initial state and final state contributions to BEs and to BE shifts, ΔBE. It is first shown how the BEs of core levels are related to the electronic structure by consideration of the BEs for a model atomic system to establish the origins and magnitudes of BE shifts. The mechanisms established for the model system are then applied to a review of XPS measurements and MO theory on a set of real examples. An important focus of the paper is to demonstrate that, in many cases, initial state mechanisms allow for a definitive interpretation of the XPS BE shifts and that an important role of theory is to provide qualitative explanations rather than quantitative agreement with XPS measurements. The mechanisms established are a guide to the interpretation of XPS measurements and consideration of these mechanisms may suggest additional calculations that would be useful. It is concluded that there is still a bright future for the coupling of ab initio MO theory with XPS measurements.

Materials Science↗
DOE OSTI2026

A conserved glycan motif induces broadly reactive functional antibodies against the zoonotic pathogen Streptococcus suis

Streptococcus suis is a largely neglected but emerging bacterial zoonotic pathogen of global concern for animal welfare, antibiotic resistance development, and human health. No effective vaccines are now available. Here, we identified and characterized the function and structure of two cell wall polysaccharide variants in pathogenic S. suis strains using genetic deletion and (heterologous) complementation, lectin staining, glycan composition analysis, and specialized NMR spectroscopy. Both glycan variants were anionic polymers that differed in the presence of glucose in the side chain as a result of allelic variation in a glycosyltransferase gene. Deletion of this variable glycosyltransferase revealed an identical glycan “core” and affected S. suis morphology and lysozyme resistance. Immunization of pigs with this core domain elicited antibodies that recognized antigenically diverse pathogenic S. suis strains and induced complement deposition on encapsulated pathogenic S. suis strains. This study provides valuable insights for developing next-generation glycoconjugate vaccines, whereby a single-glycan target could protect against the emerging zoonotic pathogen S. suis.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2020

Programming Strategies for Irregular Algorithms on the Emu Chick

The Emu Chick prototype implements migratory memory-side processing in a novel hardware system. Rather than transferring large amounts of data across the system interconnect, the Emu Chick moves lightweight thread contexts to near-memory cores before the beginning of each remote memory read. Previous work has characterized the performance of the Chick prototype in terms of memory bandwidth and programming differences from more typical, non-migratory platforms, but there has not yet been an analysis of algorithms on this system. This work evaluates irregular algorithms that could benefit from the lightweight, memory-side processing of the Chick and demonstrates techniques and optimization strategies for achieving performance in sparse matrix-vector multiply operation (SpMV), breadth-first search (BFS), and graph alignment across up to eight distributed nodes encompassing 64 nodelets in the Chick system. We also define and justify relative metrics to compare prototype FPGA-based hardware with established ASIC architectures. The Chick currently supports up to 68x scaling for graph alignment, 80 MTEPS for BFS on balanced graphs, and 50% of measured STREAM bandwidth for SpMV.

Hein, Eric↗
DOE OSTI2026

Dataset 3: A National Dataset on Actionable Items in Improving Pooled Rideshare, 2025.

Dataset 3: A National Dataset on Actionable Items in Improving Pooled Rideshare.” 2025. Dataset Description: Pooled Rideshare Acceptance Survey - Phase 3 (2025, N = 8,296). This dataset represents the third and final phase of a national survey aimed at understanding user acceptance and preferences related to pooled rideshare (PR) services in the United States. Building on insights from earlier phases, this phase expands both the sample size and the depth of analysis to support policymaking, transportation planning, and service design for sustainable mobility systems. The Phase 3 survey was administered online to a nationally representative sample of 8,296 U.S. adults. The sample includes a wide range of demographics. The survey retained core questions from previous phases while introducing 77 detailed service features (actionable items) to evaluate potential improvements to PR offerings. Each feature was designed to assess whether a specific improvement, such as enhanced safety measures, real-time ride tracking, or user training would increase participants’ willingness to adopt PR services. In addition, behavioral predictors, current rideshare habits, environmental attitudes, and perceived barriers (e.g., safety, privacy, and comfort) were captured. - Phase_3_Final - The dataset contains rows corresponding to individual respondents and columns representing survey items, demographic characteristics, and response values. The data is available in both .CSV and .SAV formats. - Phase_3_Final_MapFile - Accompanying this dataset is a data dictionary explaining each variable, value range, and coding schema. An .XLSX format of the full survey instrument is included to support interpretation and reuse of the dataset.

32 ENERGY CONSERVATION, CONSUMPTION, AND UTILIZATI↗
DOE OSTI2020

Hard x-ray standing-wave photoemission study of the interfaces in a BiFeO$_3$/La$_{0.7}$Sr$_{0.3}$MnO$_3$ superlattice

Hybrid multiferroics such as BiFeO$_3$ (BFO) and La$_{0.7}$Sr$_{0.3}$MnO$_3$ (LSMO) heterostructures are highly interesting functional systems due to their complex electronic and magnetic properties. One of the key parameters influencing the emergent properties is the quality of interfaces, where varying interdiffusion lengths can give rise to different chemistry and distinctive electronic states. Here we report high-resolution depth resolved chemical and electronic investigation of BFO/LSMO superlattice using standing-wave hard X-ray photoemission spectroscopy in the first-order Bragg as well as near-total-reflection geometry. Our results show that the interfaces of BFO on top of LSMO are atomically abrupt, while the LSMO on top of BFO interfaces show an interdiffusion length of around 1.2 unit cells. The two interfaces also exhibit different chemical gradients, with the BFO/LSMO interface being Sr-terminated by a spectroscopically distinctive high binding energy component in Sr 2p core-level spectra, which is spatially contained within 1 unit cell from the interface. From the electronic point of view, unique valence band features were observed for bulk-BFO, bulk-LSMO and their interfaces. Our X-ray optical analysis revealed a unique electronic signature at the BFO/LSMO interface, which we attribute to the coupling between those respective layers. Valence band decomposition based on the Bragg-reflection standing-wave measurement also revealed the band alignment between BFO and LSMO layers. Our work demonstrates that standing-wave hard x-ray photoemission is a reliable non-destructive technique for probing depth-resolved electronic structure of buried layers and interfaces with sub-unit-cell resolution. Equivalent investigations can be successfully applied to a broad class of material such as perovskite complex oxides with emergent interfacial phenomena.

Martins, HP↗
DOE OSTI2021

Planar Transformer With Asymmetric Integrated Leakage Inductance Using Horizontal Air Gap

This article presents a novel planar-based transformer winding and core structure with controllable leakage inductance generation for integrated magnetics applications. As a result of limitations in integrated magnetics from the literature, a new approach is proposed utilizing semi-interleaved windings and controllable leakage via a leakage flux core leg featuring a horizontal air gap. Here, the proposed transformer design is analyzed via detailed reluctance modeling to determine closed-form equations for the magnetizing and asymmetrically distributed leakage inductances. Next, a genetic-algorithm-based multiobjective design optimization problem is developed, seeking to minimize the core and winding losses of the proposed transformer subject to a set of parametric and geometric constraints in a dc-ac dual-active-bridge topology for microinverter applications. The optimization was extended to include other integrated magnetic structures from the literature, where it is determined that the proposed transformer is superior from the perspectives of efficiency, footprint area, and parasitic capacitance. Based on the results of the optimization analysis, two designs with theoretical transformer California Energy Commission (CEC) efficiency drops (i.e., CEC efficiency reduction specifically due to the transformer loss mechanisms) of 1.19% and 0.83% were fabricated and evaluated for electrical and thermal performance in the proposed 40 V, 400 W microinverter.

42 ENGINEERING↗
DOE OSTI2023

HEPnOS: a Specialized Data Service for High Energy Physics Analysis

In this paper, we present HEPnOS, a distributed data service for managing data produced by high-energy physics (HEP) experiments. Using HEPnOS, HEP applications can use HPC resources more effciently than traditional fle-based applications. The fle-based model leads to a rigid, chunk-based allocation of computational resources and limits the number of cores that can be used concurrently by an HEP application. The fundamental problem is that organizing domain-specifc data into fles inadvertently introduces a single, artifcial, confated tuning parameter that puts key optimization goals into confict: larger fle sizes reduce metadata overhead and thus improve I/O effciency, but smaller fle sizes provide more opportunity for workfow parallelism and load balancing. In this work, we introduce a domain-specifc data service that decouples that constraint so that data can be accessed and processed in its natural granularity while still maintaining I/O effciency. By removing the constraints introduced by fle handling we are able to obtain better scaling and make effcient use of more cores for processing a fxed-sized data sample. We demonstrate the improved scalability by using an application developed in the fle-based paradigm and comparing it to a version modifed to use HEPnOS.

72 PHYSICS OF ELEMENTARY PARTICLES AND FIELDS↗