Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “transient analysis”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,117 records · Page 62
All sourcesNASA NTRSDOE OSTI
DOE OSTI2025

Demonstration of the surveillance test article for an advanced reactor surveillance test program

Operational environments in generation IV reactors involve corrosive and irradiative conditions at elevated temperatures. Typical reactor operations consist of transients which impose cyclic loads on reactor components. These cyclic loads, combined with corrosive and irradiative environments, result in synergistic degradation of component materials. However, limited data exists on the coupled damage effects on materials for reactor environments. While the surrogate material surveillance concept has been used in light water reactors to assess irradiation damage, existing material surveillance technologies are not suitable for in-situ monitoring of coupled material degradation. The materials surveillance program focuses on material degradation management and the estimation of remaining life of reactor components through surveillance test articles. This paper presents the design and analysis methodology of a bi-metal surveillance test article, which uses difference in thermal expansion coefficient between two metals to induce in-situ cyclic loads. This report presents the work conducted in FY 25, to test the surveillance test article in air and salt environments. These test specimens were evaluated after thermal cycle exposure and remaining life is measured through creep test.

36 - MATERIALS SCIENCE↗
DOE OSTI2020

Autonomous adaptive data acquisition for scanning hyperspectral imaging

Non-invasive and label-free spectral microscopy (spectromicroscopy) techniques can provide quantitative biochemical information complementary to genomic sequencing, transcriptomic profiling, and proteomic analyses. However, spectromicroscopy techniques generate high-dimensional data; acquisition of a single spectral image can range from tens of minutes to hours, depending on the desired spatial resolution and the image size. This substantially limits the timescales of observable transient biological processes. To address this challenge and move spectromicroscopy towards efficient real-time spatiochemical imaging, we developed a grid-less autonomous adaptive sampling method. Our method substantially decreases image acquisition time while increasing sampling density in regions of steeper physico-chemical gradients. When implemented with scanning Fourier Transform infrared spectromicroscopy experiments, this grid-less adaptive sampling approach outperformed standard uniform grid sampling in a two-component chemical model system and in a complex biological sample, Caenorhabditis elegans. We quantitatively and qualitatively assess the efficiency of data acquisition using performance metrics and multivariate infrared spectral analysis, respectively.

47 OTHER INSTRUMENTATION↗
DOE OSTI2022

Time-resolved CO 2 , CO, and N 2 vibrational population measurements in Ns pulse discharge plasmas

Abstract Time-resolved CO 2 and N 2 vibrational populations and translational-rotational temperature are measured in a CO 2 –N 2 plasma sustained by a ns pulse discharge burst in plane-to-plane geometry. Time-resolved, absolute number density of CO generated in the plasma is also inferred from the experimental data. CO 2 and CO vibrational populations are measured by mid-IR, tunable quantum cascade laser absorption spectroscopy, and N 2 vibrational populations are measured by the ns broadband vibrational CARS. Transient excitation of N 2 and CO 2 asymmetric stretch vibrational energy modes is detected during the discharge burst. The time-resolved rate of CO generation does not correlate with N 2 or CO 2 ( ν 3 ) vibrational temperatures, indicating that CO 2 dissociation via the vibrational excitation is insignificant at the present conditions. The rate of CO generation decreases gradually during the discharge burst. The estimated specific energy cost of the CO product is close to that of N atoms in pure nitrogen, measured previously at similar operating conditions. Comparison of the experimental data with the kinetic modeling analysis indicates that CO 2 dissociation in collisions with electronically excited N 2 molecules is the dominant channel of CO generation at the present conditions, although the inferred CO yield in these processes is significantly lower than 1. The effect of vibrational energy transfer between N 2 and CO 2 on the plasma chemical processes is insignificant. The kinetic model underpredicts a rapid reduction of the N 2 and CO 2 ( ν 3 ) vibrational temperatures during the later half of the discharge burst and in the afterglow. V–T relaxation of N 2 by N and O atoms generated in the ns pulse discharge plasma does not affect the vibrational relaxation rate in a significant way. However, rapid V–T relaxation of CO 2 by O atoms has a significant effect on the relaxation rate. The difference between the experimental data and the modeling predictions may be due to the unknown scaling of the CO 2 –O V–T rates with the vibrational quantum number.

Physics↗
DOE OSTI2020

Molecular bond stabilization in the strong-field dissociation of O 2 +

We theoretically examine the rotational and vibrational dynamics of O 2 + molecular ions exposed to intense, short laser pulses for conditions realized in contemporary pump-probe experiments. We solve the time-dependent Schrödinger equation within the Born-Oppenheimer approximation for an initial distribution of randomly aligned molecular ions. For fixed peak intensities, our numerical results show that total, angle-integrated O 2 + → O( 3 P) + O + ( 4 S 0 ) dissociation yields do not monotonically increase with increasing infrared-probe pulse duration. We find this pulse-duration-dependent stabilization to be consistent with the transient trapping of nuclear probability density in a light-induced (bond-hardening) potential-energy surface and robust against rotational excitation. We analyze this stabilization effect and its underlying bond-hardening mechanism (i) in the time domain, by following the evolution of partial nuclear probability densities associated with the dipole-coupled O 2 + (a 4 Π u ) and O 2 + (f 4 Π g ) cationic states, and (ii) in the frequency domain, by examining rovibrational quantum-beat spectra for the evolution of the partial nuclear probability densities associated with these states. In this work, our analysis reveals the characteristic timescale for the bond-hardening mechanism in O 2 + and explains the onset of bond stabilization for sufficiently long pulse durations.

74 ATOMIC AND MOLECULAR PHYSICS↗
DOE OSTI2021

Preferential Direction of Electron Transfers at a Dye–Metal Oxide Interface with an Insulating Fluorinated Self-Assembled Monolayer and MgO

Slowing non-desirable electron transfer reactions at metal oxide-dye interfaces is important for many technologies. Specifically, after an interfacial photoinduced charge separation event at a metal oxide-dye interface, it is critically important to limit the rate of electron transfer reactions back to sensitizers and to limit electron transfer reactions between the electrolyte and the metal oxide. Ruthenium-based dyes at metal oxide interfaces are widely used in many fields; however, these dyes often have poor surface insulation resulting in fast recombination kinetics with transition metal-based redox shuttles in an electrolyte. This work explores two semiconductor surface modification strategies designed to minimize recombination events of electrons in TiO 2 with oxidized redox shuttles using a fluorinated siloxane insulator (PFTS) and a metal oxide insulator (MgO) with a well-known Ru dye, B11. Additionally, the influence of these treatments on the rate and duration of photoinduced interfacial charge separation at the TiO 2 -dye interface was examined. The TiO 2 -dye-redox shuttle systems were studied via dye-sensitized solar cell current-voltage curve, incident photon-to-current conversion efficiency, small-modulated photovoltage transient, time-correlated single photon counting, and transient absorption spectroscopy measurements. MgO was found to decrease the rate of the electron transfer reaction from the metal oxide to the electrolyte, decrease the rate of the electron transfer reaction to the oxidized dye from TiO 2 , increase the electron transfer reaction rate from a reduced redox shuttle to an oxidized dye, and decrease the electron injection rate from the photoexcited dye to TiO2. Interestingly, PFTS was found to desirably improve on these rates relative to MgO or untreated TiO 2 . Here, a model based on electrostatic interactions is presented to explain the exceptional behavior of PFTS with DFT computational analysis of PFTS supporting this model.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2023

Microgrid Modeling for Stability Analysis

Here this document is a summary of a report prepared by the IEEE PES Task Force (TF) on Microgrid (MG) Dynamic Modeling, IEEE Power and Energy Society, Tech. Rep. PES-TR106, 2023. In this paper, the major issues and challenges in microgrid modeling for stability analysis are discussed, and a review of state-of-the-art modeling approaches and trends is presented. In the context of the IEEE 1547 standard, the document covers issues associated with component models for MG dynamic studies and simulations, including generator and grid modeling, full and average converter models, unbalanced and balanced system conditions, dynamic and static loads, protection requirements, and detailed and simplified controls considering communications delays, packet losses, and security issues. Considering the future integration of grids and MGs to form broad integrated networks, a discussion is presented of the use of phasor vis-à-vis electromagnetic transient simulation tools for MG dynamic stability studies, as well as modeling scale-up issues and MG equivalent models. Specifically white-, grey-, and black-box models, are presented. This TF paper and companion report constitute a modeling guide for R&D groups working on developments and standards of MGs with a focus on stability issues.

32 ENERGY CONSERVATION, CONSUMPTION, AND UTILIZATI↗
DOE OSTI2023

Modeling of Prismatic High Temperature Reactors in Pronghorn

Pronghorn is a MOOSE based thermal-hydraulics code developed at Idaho National Laboratory (INL) for advanced nuclear reactor analysis. It has been previously applied to model pebble-bed high temperature reactors (HTRs), liquid-metal cooled reactors, and molten salt reactors, among others. This work leverages the coarse-mesh modeling capabilities in Pronghorn to model the Oregon State University (OSU)'s High Temperature Test Facility (HTTF). The HTTF is a 1:4 height scaled-down facility of General Atomics' Modular High Temperature Gas-cooled Reactor (MHTGR). The facility is primarily built to generate data for code and model validation, and does not precisely replicate MHTGR conditions. Nevertheless, it encompasses the main physics associated with MHTGR transients.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2021

Catalase protects against nonenzymatic decarboxylations during photorespiration in Arabidopsis thaliana

Abstract Photorespiration recovers carbon that would be otherwise lost following the oxygenation reaction of rubisco and production of glycolate. Photorespiration is essential in plants and recycles glycolate into usable metabolic products through reactions spanning the chloroplast, mitochondrion, and peroxisome. Catalase in peroxisomes plays an important role in this process by disproportionating H 2 O 2 resulting from glycolate oxidation into O 2 and water. We hypothesize that catalase in the peroxisome also protects against nonenzymatic decarboxylations between hydrogen peroxide and photorespiratory intermediates (glyoxylate and/or hydroxypyruvate). We test this hypothesis by detailed gas exchange and biochemical analysis of Arabidopsis thaliana mutants lacking peroxisomal catalase. Our results strongly support this hypothesis, with catalase mutants showing gas exchange evidence for an increased stoichiometry of CO 2 release from photorespiration, specifically an increase in the CO 2 compensation point, a photorespiratory‐dependent decrease in the quantum efficiency of CO 2 assimilation, increase in the 12 CO 2 released in a 13 CO 2 background, and an increase in the postillumination CO 2 burst. Further metabolic evidence suggests this excess CO 2 release occurred via the nonenzymatic decarboxylation of hydroxypyruvate. Specifically, the catalase mutant showed an accumulation of photorespiratory intermediates during a transient increase in rubisco oxygenation consistent with this hypothesis. Additionally, end products of alternative hypotheses explaining this excess release were similar between wild type and catalase mutants. Furthermore, the calculated rate of hydroxypyruvate decarboxylation in catalase mutant is much higher than that of glyoxylate decarboxylation. This work provides evidence that these nonenzymatic decarboxylation reactions, predominately hydroxypyruvate decarboxylation, can occur in vivo when photorespiratory metabolism is genetically disrupted.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Stereoscopic high-speed microscopy to understand transient internal flow processes in high-pressure nozzles

The flow and cavitation behavior inside fuel injectors is known to affect spray development, mixing and combustion characteristics. We discuss that while diesel fuel injectors with converging and hydro-eroded holes are generally known to limit cavitation and feature higher discharge coefficients during the steady period of injection, less is known about the flow during transient periods corresponding to needle opening and closing. Multiple injection strategies involve short injections, multiplying these aspects and giving them a growing importance as part of the fuel delivery process. In this study, single-hole transparent nozzles were manufactured with the same hole inlet radius and diameter as the Engine Combustion Network Spray D nozzle, mounted to a modified version of a common-rail Spray A injector body and needle. Needle opening and closing periods were visualized with stereoscopic high-speed microscopy at injection pressures relevant to modern diesel engines. Time-resolved sac pressure was extracted via elastic deformation analysis of the transparent nozzles. Sources of cavitation were observed and tracked, enabling the identification of a gas exchange process after the end of injection with ingestion of chamber gas into the sac and orifice. We observed that the gas exchange contributed widely to disrupting the start of injection and outlet flow during the subsequent injection event.

42 ENGINEERING↗
DOE OSTI2022

Fluid structure interaction of a subaqueous pendulum: Analyzing the effect of wake correction via large eddy simulations

The dynamic behavior of a subaqueous cylindrical pendulum and corresponding flow dynamics are investigated. The objectives were twofold: (i) to examine whether the two-dimensional model equations sufficiently capture the three-dimensional dynamics and (ii) to investigate the emerging three-dimensional vortical flow structures. Large eddy simulations with two-way coupling fluid structure interaction were carried out using the immersed boundary method to simulate the motion of the pendulum and its interactions with the initially stagnant water. The resulting pendulum motion is compared against measured data obtained in a series of experimental tests to validate the simulation results and the model equations with and without wake corrections. An analysis of the flow vorticity revealed the development of a vortex ring during the first swing and the formation of tip vortices. The evolution of the vortex rings emerging from the motion of the subaqueous cylindrical pendulum was visualized using Q-criteria showing a reasonable agreement with vortical structures observed in the experiment using particle imaging velocimetry. The hydrodynamic moments acting on the simulated pendulum and the moments calculated from the model equations are analyzed. Using the insights from these numerical simulations, a modification of the wake correction is proposed to enhance the accuracy of the rate of decay and period. The transient effect of coherent flow on pendulum dynamics, especially the added mass effect, is discussed.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2022

Inferring small-sample-reactivity worth from oscillation experiment with auto-corrected local flux

To estimate reactivity changes as a function of time from the signal of detectors count rates, one usually uses point kinetic equations. However, when detectors are located inside the core, it is often necessary to compute a correction factor to account for the flux-shape deformation (i.e. the change of detector efficiency that may have been induced by neutron absorbers movements). Various simulation methods have been developed depending on transients observed. They range from the resolution of static equations up to full-time-dependent neutron transport in 3D. However, those methods require high computational-cost calculations of local reaction rates that rely on nuclear data evaluations. Therefore, a 'measured' reactivity is never determined through pure measurements. Taking advantage of the known oscillation movement of a small sample at the center of the MINERVE reactor, the innovative algorithm presented in this paper derives the correction factor needed to get no time drift on reactivity steps. Derived correction factors are in good agreement with those obtained independently with TRIPOLI-4 through sensitivity analysis. Low sensitivity to the sample composition and moderate sensitivity to the detectors position reinforce the reliability of those results. This application paves the way to almost pure nuclear data reactivity measurements. (authors)

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗
DOE OSTI2023

Phonon-informed Neural Thermal Scattering (NeTS) Optimization for Crystalline Graphite and Beryllium Metal

Fast neutrons born from fission lose energy through scattering interactions in the process of slowing-down. As neutrons thermalize to the order of $k$ $b$ $T$ (where $k$ $b$ is the Boltzmann constant, and $T$ is the temperature of the medium), their de Broglie wavelength and energy approaches the order of inter-atomic spacing and quantized lattice vibrations, i.e., phonons. At thermal energies, the thermal scattering law (TSL), i.e., $S$($α, β$), captures crystal binding contributions to the total reaction rate, or cross section. This dimensionless material property describes the energy ($β$) and momentum ($α$) exchanges available in a medium. Currently, $S$($α, β$) is evaluated in the Full Law Analysis Scattering System Hub (FLASSH) code for discrete inputs and stored as ENDF/B File 7 for 0-phonon elastic (MT 2) and n-phonon inelastic (MT 4) processes. Further processing recasts $S$($α, β$) into cumulative distribution functions for sampling post-collision scattering kinematics. In practice, interpolation schemes are employed to access data between tabulated values. An improvement to this juncture of the nuclear data pipeline is supplying cross sections on-the-fly (OTF), as has been developed for the un-resolved resonance region to minimize non-physical interpolation errors. This capability may improve simulation accuracy for accident and transient analyses, where rapidly varying changes in temperature and pressure are difficult to predict beforehand. To do so, deep artificial neural networks (ANNs) can be employed which collapse non-linear, complex data into a lightweight dictionary of neural weights and biases. This has been successfully demonstrated for the hydrogen in light water $S$($α, β$) dataset in the form of a Neural Thermal Scattering (NeTS) module. In this work, the NeTS framework is extended to consider the impact of material-dependent dynamical features on optimal neural pre-processing and architecture design decisions, such as number of neurons per hidden layer, residual skip connections and neural depth. New NeTS modules for crystalline graphite and beryllium metal illuminate a novel correlation between dynamical nonlinearity and optimal neural parametrization when deploying $S$($α, β$) on-the-fly.

73 NUCLEAR PHYSICS AND RADIATION PHYSICS↗
DOE OSTI2021

Nitrene Photochemistry of Manganese N ‐Haloamides**

Abstract Manganese complexes supported by macrocyclic tetrapyrrole ligands represent an important platform for nitrene transfer catalysis and have been applied to both C−H amination and olefin aziridination catalysis. The reactivity of the transient high‐valent Mn nitrenoids that mediate these processes renders characterization of these species challenging. Here we report the synthesis and nitrene transfer photochemistry of a family of Mn III N ‐haloamide complexes. The S= 2 N ‐haloamide complexes are characterized by 1 H NMR, UV‐vis, IR, high‐frequency and ‐field EPR (HFEPR) spectroscopies, and single‐crystal X‐ray diffraction. Photolysis of these complexes results in the formal transfer of a nitrene equivalent to both C−H bonds, such as the α‐C−H bonds of tetrahydrofuran, and olefinic substrates, such as styrene, to afford aminated and aziridinated products, respectively. Low‐temperature spectroscopy and analysis of kinetic isotope effects for C−H amination indicate halogen‐dependent photoreactivity: Photolysis of N ‐chloroamides proceeds via initial cleavage of the Mn−N bond to generate Mn II and amidyl radical intermediates; in contrast, photolysis of N ‐iodoamides proceeds via N−I cleavage to generate a Mn IV nitrenoid (i.e., {MnNR} 7 species). These results establish N ‐haloamide ligands as viable precursors in the photosynthesis of metal nitrenes and highlight the power of ligand design to provide access to reactive intermediates in group‐transfer catalysis.

Van Trieste, III, Gerard P.↗
DOE OSTI2023

Assessment of Bulk Oxygen Capacity and Transient Redox Behavior of Foamed Lanthanum Strontium Manganese Perovskites

Synthesis of solar thermochemical hydrogen (STCH) production redox materials with engineered structures, for example, replica foams, can enable efficient heat and mass transport and are critical for scaled-up systems. Prior work has motivated the use of lanthanum strontium manganese (LSM)-type perovskites as foamed STCH materials, but the effect of their morphology on bulk and kinetic behavior has not been reported. In this work, replica and direct foamed samples of La 0.65 Sr 0.35 MnO 3-δ (LSM35) were fabricated and compared to synthesized powders and dense monoliths, and similarly synthesized CeO 2-δ (ceria) foams, regarding their specific reaction rates and bulk oxygen capacity/H 2 yields. Changes in oxygen capacity (Δδ) and reaction rates were measured between 1200 °C and 1400 °C by using fixed ratios of steam and hydrogen during both reduction and oxidation steps, allowing for analysis under practical high conversion conditions. Results suggest bulk behavior and reaction rates of the foamed LSM materials are comparable to their powder analogues. Differences in reaction rates were observed only when replica foamed samples were subjected to rapid laser heating (emulating conditions expected in solar furnaces), which is expected but has not been demonstrated at such a small scale. Here, foamed samples were further subjected to 50 redox cycles at 1400 °C to evaluate their stability. Results show no statistically significant decrease in hydrogen production for any of the foamed samples, but the direct foamed samples became brittle with time. Together, these results demonstrate the viability of replica foamed LSM perovskites for integration in scaled-up STCH systems.

08 HYDROGEN↗
DOE OSTI2021

A propagation-based fault detection and discrimination method and the optimization of sensor deployment

Industrial processes can be affected by faults having a serious impact on operation when not promptly detected and diagnosed. Here in this paper, a propagation-based fault detection and discrimination(PFDD) method is proposed to develop a strategy for fault diagnosis while in the design phase of a system. The PFDD method constructs the system model using the Integrated System Fault Analysis(ISFA) technique. Based on the system model, the propagation of hardware and software faults are simulated qualitatively. Given the results of the simulation, the process by which a fault propagates can be characterized using the qualitative features of system variables including the deviation of the system variables from their expected values, the variation of the system variables over time, and the order in which each variable is influenced during the propagation of the fault. The strategy by which a fault can be detected and discriminated is defined using those features. The PFDD method supports the detection and discrimination of faults in both steady states and transient states. Based on the PFDD method, the optimization of sensor deployment in a system is discussed. A brute force algorithm is developed to examine the system’s capability at diagnosing faults and the cost of sensor deployment for all possible configurations of sensors. The optimal sensor deployment strategy can be derived accordingly. However, the brute force method is only applicable to small-scale systems due to its high computational cost. A genetic algorithm is used to optimize sensor deployment in large-scale systems. The PFDD and sensor deployment optimization methods are applied to the Experimental Breeder Reactor II (EBR-II) for verification.

46 INSTRUMENTATION RELATED TO NUCLEAR SCIENCE AND ↗
DOE OSTI2021

Anaerobic Microbial Metabolism of Dichloroacetate

Dichloroacetate (DCA) commonly occurs in the environment due to natural production and anthropogenic releases, but its fate under anoxic conditions is uncertain. Mixed culture RM comprising “Candidatus Dichloromethanomonas elyunquensis” strain RM utilizes DCA as an energy source, and the transient formation of formate, H 2 , and carbon monoxide (CO) was observed during growth. Only about half of the DCA was recovered as acetate, suggesting a fermentative catabolic route rather than a reductive dechlorination pathway. Sequencing of 16S rRNA gene amplicons and 16S rRNA gene-targeted quantitative real-time PCR (qPCR) implicated “Candidatus Dichloromethanomonas elyunquensis” strain RM in DCA degradation. An (S)-2-haloacid dehalogenase (HAD) encoded on the genome of strain RM was heterologously expressed, and the purified HAD demonstrated the cofactor-independent stoichiometric conversion of DCA to glyoxylate at a rate of 90 ± 4.6 nkat mg -1 protein. Differential protein expression analysis identified enzymes catalyzing the conversion of DCA to acetyl coenzyme A (acetyl-CoA) via glyoxylate as well as enzymes of the Wood-Ljungdahl pathway. Glyoxylate carboligase, which catalyzes the condensation of two molecules of glyoxylate to form tartronate semialdehyde, was highly abundant in DCA-grown cells. The physiological, biochemical, and proteogenomic data demonstrate the involvement of an HAD and the Wood-Ljungdahl pathway in the anaerobic fermentation of DCA, which has implications for DCA turnover in natural and engineered environments, as well as the metabolism of the cancer drug DCA by gut microbiota.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Tracing priming effects in palsa peat carbon dynamics using a stable isotope-assisted metabolomics approach

Introduction: Peatlands store up to a third of global soil carbon, and in high latitudes their litter inputs are increasing and changing in composition under climate change. Although litter significantly influences peatland carbon and nutrient dynamics by changing the overall lability of peatland organic matter, the physicochemical mechanisms of this impact—and thus its full scope—remain poorly understood. Methods: We applied multimodal metabolomics (UPLC-HRMS, 1 H NMR) paired with 13 C Stable Isotope-Assisted Metabolomics (SIAM) to track litter carbon and its potential priming effects on both existing soil organic matter and carbon gas emissions. Through this approach, we achieved molecule-specific tracking of carbon transformations at unprecedented detail. Results: Our analysis revealed several key findings about carbon dynamics in palsa peat. Microbes responded rapidly to litter addition, producing a short-term increase in CO 2 emissions, fueled nearly exclusively by transformations of litter carbon. Litter inputs significantly contributed to the organic nitrogen pool through amino acids and peptide derivatives, which served as readily accessible nutrient sources for microbial communities. We traced the fate of plant-derived polyphenols including flavonoids like rutin, finding evidence of their degradation through heterocyclic C-ring fission, while accumulation of some polyphenols suggested their role in limiting overall decomposition. The SIAM approach detected subtle molecular changes indicating minimal and transient priming activity that was undetectable through conventional gas measurements alone. This transient response was characterized by brief microbial stimulation followed by rapid return to baseline metabolism. Pre-existing peat organic matter remained relatively stable; significant priming of its consumption was not observed, nor was its structural alteration. Discussion: This suggests that while litter inputs temporarily increase CO 2 emissions, they don’t sustain long-term acceleration of stored carbon decomposition or substantially decrease peat’s carbon store capacity. Our findings demonstrate how technological advancements in analytical tools can provide a more detailed view of carbon cycling processes in complex soil systems.

54 ENVIRONMENTAL SCIENCES↗