Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “sequence analysis”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,081 records · Page 60
All sourcesNASA NTRSDOE OSTI
DOE OSTI2023

SSGUI v1.0

SSGUI is a web-based application that integrates the integrative genomics browser (IGV) with upstream alignment pipelines enabling rapid analysis of a batch of next-generation sequencing (NGS) samples. The input to SSGUI is an NGS file system directory that is organized by experiment and reference sequence. The output is an online dashboard containing various sequencing statistics for each sample and an integrated IGV plugin enabling rapid analysis of aligned NGS reads.

Kulawik, Mark↗
NASA NTRS1986

Functional and evolutionary relationships between bacteriorhodopsin and halorhodopsin in the archaebacterium, halobacterium halobium

The archaebacteria occupy a unique place in phylogenetic trees constructed from analyses of sequences from key informational macromolecules, and their study continues to yield interesting ideas on the early evolution and divergence of biological forms. It is now known that the halobacteria among these species contain various retinal-proteins, resembling eukaryotic rhodopsins, but with different functions. Two of these pigments, located in the cytoplasmic membranes of the bacteria, are bacteriorhodopsin (a light-driven proton pump) and halorhodopsin (a light-driven chloride pump). Comparison of these systems is expected to reveal structure/function relationships in these simple (primitive?) energy transducing membrane components and evolutionary relationships which had produced the structural features which allow the divergent functions. Findings indicate that very different primary structures are needed for these proteins to accomplish their different functions. Indeed, analysis of partial amino acid sequences from halo-opsin shows already that few if any long segments exist which are homologous to bacterio-opsin. Either these proteins diverged a very long time ago to allow for the observed differences, or the evolutionary clock in the halobacteria runs faster than usual.

Lanyi, J. K.↗
NASA NTRS2012

The Role of (Delta)C-13 in the Search for Reduced Organics on the Surface of Mars

The capabilities of the Sample Analysis at Mars (SAM) instrument suite on the Mars Science Laboratory (MSL) to detect trace amounts of organic carbon compounds are unprecedented, and MSL may be the first mission to reveal the presence of organic carbon on Mars. The search for reduced organic carbon on Mars is inextricably tied to: a) the preservation potential of the environment from which we take a solid sample, and b) the evolved gas analysis (EGA) techniques used by SAM to release volatiles from this solid sample. Several prospective targets have been identified for sample analysis at Gale Crater. Stratigraphic sequences of phyllosilicates and sulfates at Gale are thought to represent a period of global climate transition from a moderate pH lacustrine environment to an evaporitic environment, both of which could sequester organic carbon (Thomson et al. 2011). The sediment mound in Gale Crater contains a range of lithologies suggesting changes in redox conditions, and evidence of both lacustrine and fluvial depositional processes, which may have transported organic carbon from the layer in which it formed and resulted in its preservation elsewhere within the crater (Anderson and Bell, 2010). Inverted channel fills suggest erosion resistant material that could serve to preserve organics originally deposited in a low energy aqueous environment. The lithology sampled will affect not only the preservation of organics, but also our ability to detect organics during our evolved gas analysis, based on the sample matrix. For example, reduced organics may be trapped in the mineral structure, and thermal evolution of these organics will occur during thermal decomposition of the host mineral. If organics are occluded in minerals that have very high thermal decomposition temperatures, they may be, in effect, "too well preserved," and difficult to detect during EGA. Alternatively, the possible presence of perchlorate, or other strong oxidants in surface regolith, may result in destruction of structural information identifying organic molecules before reaching the QMS on SAM via oxidation to C02 during heating. If this is the case, the stable carbon isotopic composition (delta 13C) of the C02 evolved and measured by the Tunable Laser Spectrometer (TLS) on SAM may help identify the presence of organics. On Earth, biological activity can cause large fractionations of 13C/12C, which can preserved in sedimentary deposits and distinguish the organic products of biotic processes from inorganic atmospheric and geological reservoirs. It is plausible that similar fractionations could occur on Mars and be preserved in reduced organic matter in sediments. Bulk delta 13C measurements alone may not reveal a signature of trace organic carbon that may be present along with inorganic carbon. If both organic and inorganic carbon compounds are present, it may be possible to detect the organic carbon by comparing the 013C of pyrolysis and combustion experiments. The TLS on SAM is capable of obtaining high precision measurements of delta13C from C02 evolved during pyrolysis and combustion of solid regolith samples. Because carbonates are expected to be present at abundances of 0.1-1 % in Martian soil, and organics in the ppb range (Webster and Mahaffy, 2011), analog samples must represent this mix of reduced organic carbon and carbonate. The work presented here will examine the use of delta13C of C02 produced during combustion of bulk Mars analog samples as a proxy for detection of reduced organic carbon.

Stern, J. C.↗
NASA NTRS2010

Model for Simulating a Spiral Software-Development Process

A discrete-event simulation model, and a computer program that implements the model, have been developed as means of analyzing a spiral software-development process. This model can be tailored to specific development environments for use by software project managers in making quantitative cases for deciding among different software-development processes, courses of action, and cost estimates. A spiral process can be contrasted with a waterfall process, which is a traditional process that consists of a sequence of activities that include analysis of requirements, design, coding, testing, and support. A spiral process is an iterative process that can be regarded as a repeating modified waterfall process. Each iteration includes assessment of risk, analysis of requirements, design, coding, testing, delivery, and evaluation. A key difference between a spiral and a waterfall process is that a spiral process can accommodate changes in requirements at each iteration, whereas in a waterfall process, requirements are considered to be fixed from the beginning and, therefore, a waterfall process is not flexible enough for some projects, especially those in which requirements are not known at the beginning or may change during development. For a given project, a spiral process may cost more and take more time than does a waterfall process, but may better satisfy a customer's expectations and needs. Models for simulating various waterfall processes have been developed previously, but until now, there have been no models for simulating spiral processes. The present spiral-process-simulating model and the software that implements it were developed by extending a discrete-event simulation process model of the IEEE 12207 Software Development Process, which was built using commercially available software known as the Process Analysis Tradeoff Tool (PATT). Typical inputs to PATT models include industry-average values of product size (expressed as number of lines of code), productivity (number of lines of code per hour), and number of defects per source line of code. The user provides the number of resources, the overall percent of effort that should be allocated to each process step, and the number of desired staff members for each step. The output of PATT includes the size of the product, a measure of effort, a measure of rework effort, the duration of the entire process, and the numbers of injected, detected, and corrected defects as well as a number of other interesting features. In the development of the present model, steps were added to the IEEE 12207 waterfall process, and this model and its implementing software were made to run repeatedly through the sequence of steps, each repetition representing an iteration in a spiral process. Because the IEEE 12207 model is founded on a waterfall paradigm, it enables direct comparison of spiral and waterfall processes. The model can be used throughout a software-development project to analyze the project as more information becomes available. For instance, data from early iterations can be used as inputs to the model, and the model can be used to estimate the time and cost of carrying the project to completion.

Mizell, Carolyn↗
DOE OSTI2025

Microreactor Assembly Transportation Cask Model Description for Criticality Safety Validation Basis Assessment

Criticality safety analyses are completed on a transportation cask used for microreactor assembly shipment to provide an example of model and analysis to industry for reproducing this type of study on their microreactor fuel shipment. The fuel assembly considered is based on a gas-cooled microreactor (GC-MR), which utilizes HALEU fuel in the form of TRISO particles and utilizes various design options considered in industry designs. Various versions of this GC-MR assembly were studied, with and without YH2 moderator, providing similar conclusions. The shipment cask design is revised based on an existing design ES-3100, developed by Y-12 for the transport of highly enriched uranium (HEU), but is enlarged to hold the GC-MR fuel assembly. Criticality safety analysis for the cask/GC-MR fuel assembly package was performed using the CSAS6 sequence of SCALE6.3.2, utilizing the ENDF/B-VII.1 based continuous energy neutron library, and the analysis strictly follows the guideline from NRC reference reports. Different scenarios, e.g. normal operation, undamaged cask with water flooded, damaged cask with optimal water moderation, have been analyzed and it could be concluded the package would always have a large margin of subcriticality even packed in an infinite array. Sensitivity and similarity analyses are also performed using the TSUNAMI sequence of SCALE6.3.2, and the similarity analysis uses all the experiments from the ICSBEP Handbook with Intermediate and Mixed Enriched Uranium (IEU) and Low Enriched Uranium (LEU) systems together with additional ones that are sponsored by the DNCSH program. These similarity analyses indicate that dry cases have no similar benchmark experiments (ck values greater than 0.8), which may become problematic if more assemblies are shipped together (or a fully loaded core is shipped) and margin to criticality is reduced. However, the damaged cask models with flooded assemblies exhibited similarities to many experiments with ck values greater than 0.8.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗
DOE OSTI2026

Microreactor Assembly Transportation Cask Model Description for Criticality Safety Validation Basis Assessment (Rev. 3)

Criticality safety analyses are completed on a transportation cask used for microreactor assembly shipment to provide an example of model and analysis to industry for reproducing this type of study on their microreactor fuel shipment. The fuel assembly considered is based on a gas-cooled microreactor (GC-MR), which utilizes HALEU fuel in the form of TRISO particles and utilizes various design options considered in industry designs. Various versions of this GC-MR assembly were studied, with and without YH 2 moderator, providing similar conclusions. The shipment cask design is revised based on an existing ES-3100 design, developed by Y-12 for the transport of highly enriched uranium (HEU), but is enlarged to hold the GC-MR fuel assembly. Criticality safety analysis for the cask/GC-MR fuel assembly package was performed using the CSAS6 sequence of SCALE6.3.2, utilizing the ENDF/B-VII.1 based continuous energy neutron library, and the analysis strictly follows the guideline from NRC reference reports. Different scenarios, e.g. normal operation, undamaged cask with water flooded, damaged cask with optimal water moderation, have been analyzed and it could be concluded the package would always have a large margin of subcriticality even packed in an infinite array. Sensitivity and similarity analyses are also performed using the TSUNAMI sequence of SCALE6.3.2, and the similarity analysis uses all the experiments from the ICSBEP Handbook with Highly Enriched Uranium (HEU), Intermediate and Mixed Enriched Uranium (IEU) and Low Enriched Uranium (LEU) systems, together with additional ones that are sponsored by the DNCSH program, and selected IRPhEP experiments using TRISO fuel and graphite moderator. These similarity analyses indicate that the dry nominal design has no similar benchmark experiments (ck values greater than 0.8), which may become problematic if more assemblies are shipped together (or a fully loaded core is shipped) and margin to criticality is reduced. However, the cask models with flooded assemblies exhibited similarities to many experiments with c k values greater than 0.8.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2014

Investigation of phase evolution of CaCu{sub 3}Ti{sub 4}O{sub 12} (CCTO) by in situ synchrotron high-temperature powder diffraction

In situ synchrotron X-ray powder diffraction was used to study the high-temperature phase evolution of CaCu{sub 3}Ti{sub 4}O{sub 12} (CCTO) precursors prepared via solid-state and sol–gel methods. After the precursors are heated to 1225 °C, the CCTO phase is the main phase observed in the calcined powder, with the presence of some minor impurities. Comparing the two precursors, we found that the onset temperature for the CCTO phase formation is 800 °C in the sol–gel precursor, lower than that in the solid-state precursor (875 °C). Intermediate phases were only observed in the sol–gel precursor. Both precursors are able to be calcined to sub-micrometric sized powders. Based on the synchrotron data along with differential scanning calorimetry (DSC) and thermal gravimetric analysis (TGA), the phase formation sequence and mechanism during calcination are proposed in this study. -- Graphical abstract: The in situ synchrotron HT-XRD patterns of CCTO sol–gel and solid-state precursor. Highlights: • Phase formation sequence/mechanism in two CCTO precursors has been established. • Formation temperature of CCTO via sol–gel method is lower than solid-state method. • Intermediate phases are only observed in the sol–gel precursor. • Both precursors are able to be calcined into sub-micrometric sized powders.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2013

Development of an Automated Remedy Performance Evaluation Program - 13622

Performance monitoring is a vital element of groundwater remediation. Unfortunately, the enormous efforts and costs that are expended procuring, managing, processing and storing monitoring data are often not subject to correspondingly rigorous evaluation. This is despite the fact that many steps in the process are predictable and are repeated many times over the remedy life cycle. At the Department of Energy (DOE) Hanford Site, a program is underway to automate many of these steps - processing, formatting any analyzing large volumes of heterogeneous data associated with the operation of several groundwater pump-and-treat (P and T) and in-situ remedies. The Automated Remedy Performance Evaluation Program (ARPEP) was developed from a work-flow process designed to deliver (a) monthly data summaries and preliminary analysis, (b) quarterly performance assessments, and (c) annual roll-up analyses that detect changes in long-term monitoring datasets and support remedy optimization. The intent of the ARPEP is to provide detailed, systematic and traceable data summaries, depictions and analyses that can be used by project scientists to complete their evaluation of remedy performance. The ARPEP work-flow was formalized following extensive review of applicable guidance, regulation and industry standards. The ARPEP incorporates disparate data types collected over different frequencies, such as water levels and pumping rates recorded every minute, and groundwater sample results obtained on quarterly, annual or irregular intervals. The data are processed, reduced to frequencies suitable for assessment, and combined in various ways leading to performance indicators such as (a) pumped well capacities and system downtime that reflect operational performance; (b) hydraulic gradients and areas of hydraulic containment that reflect hydraulic performance; and (c) time-series (longitudinal) and geo-statistical (spatial) trend analyses that reflect progress toward attainment of Remedial Action Objectives (RAOs). The entire sequence of data processing and analysis is undertaken within the R programming environment, an open-source environment for statistical computing and graphics, and is summarized in a comprehensive PDF project report. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
NASA NTRS2012

TraceContract

TraceContract is an API (Application Programming Interface) for trace analysis. A trace is a sequence of events, and can, for example, be generated by a running program, instrumented appropriately to generate events. An event can be any data object. An example of a trace is a log file containing events that a programmer has found important to record during a program execution. Trace - Contract takes as input such a trace together with a specification formulated using the API and reports on any violations of the specification, potentially calling code (reactions) to be executed when violations are detected. The software is developed as an internal DSL (Domain Specific Language) in the Scala programming language. Scala is a relatively new programming language that is specifically convenient for defining such internal DSLs due to a number of language characteristics. This includes Scala s elegant combination of object-oriented and functional programming, a succinct notation, and an advanced type system. The DSL offers a combination of data-parameterized state machines and temporal logic, which is novel. As an extension of Scala, it is a very expressive and convenient log file analysis framework.

Kavelund, Klaus↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Transfer of beef bacterial communities onto food-contact surfaces

Introduction Food spoilage and pathogenic bacteria on food-contact surfaces, especially biofilm-forming strains, can transfer to meats during processing. The objectives of this study were to survey the bacterial communities of beef cuts that transfer onto two commonly used food-contact surfaces, stainless steel (SS) and high-density polyethylene (HDPE) and identify potentially biofilm-forming strains. Methods Top round, flank, chuck, and ground beef were purchased from 3 retail stores. SS and HDPE coupons (approximately 2cm × 5cm) were placed on beef portions (3h, 10°C), after which, the coupons were submerged halfway in PBS (24h, 10°C). Bacteria from the beef cuts and coupon surfaces ( n = 3) were collected, plated on tryptic soy agar plates and incubated (5 days, 25°C). Bacterial isolates were identified by 16S rRNA gene amplicon sequencing and assayed for biofilm formation using a crystal violet binding (CV) assay (72h, 10°C). Additionally, beef and coupon samples were collected for bacterial community analysis by 16S rRNA gene amplicon sequencing. Results and discussion Sixty-one of 972 beef isolates, 29 of 204 HDPE isolates, and 30 of 211 SS isolates were strong biofilm-formers (Absorbance>1.000 at 590 nm in the CV assay). Strong-binding isolates identified were of the genera Pseudomonas , Acinetobacter , Psychrobacter , Carnobacterium , and Brochothrix . Coupon bacterial communities among stores and cuts were distinct ( p < 0.001, PERMANOVA), but there was no distinction between the communities found on HDPE or SS coupons ( p > 0.050, PERMANOVA). The bacterial communities identified on the coupons may help determine the communities capable of transferring and colonizing onto surfaces, which can subsequently cross-contaminate foods.

Guron, Giselle K. P.↗
DOE OSTI2025

The role of soil chemical properties and microbial communities on Dendrocalamus brandisii bamboo shoot quality, Yunnan Province, China

Objective To explore the effects of soil nutrients and microbial communities on the quality of Dendrocalamus brandisii shoots in different regions, providing a scientific basis for their development and utilization. Methods Using seven different geographic sources of D. brandisii from Yunnan Province as research subjects, this study employs chemical analysis and high-throughput sequencing to reveal the relationship between soil nutrients, microbial functional groups, and the nutritional quality of bamboo shoots. Results The results indicate that there are significant differences in soil nutrient content among the regions ( p < 0.05), with bamboo shoots from Baoshan Changning (CN) exhibiting the best overall nutritional quality. The key factors influencing bacterial community changes include pH, available phosphorus (AP), and available potassium (AK). In contrast, the main factors affecting fungal community changes are pH, soil organic matter (SOM), available potassium (AK), and total nitrogen (TN). This version maintains clarity and logical flow, making it easier for readers to understand the different factors influencing bacterial and fungal community changes. The diversity indices of soil microbial communities among different sources of Dendrocalamus brandisii show significant differences ( p < 0.05). The dominant groups in the seven regions include Proteobacteria, Acidobacteriota, Actinobacteriota, Chloroflexi, Ascomycota, and Basidiomycota. The soil microbial community in Baoshan Changning (CN) shows significant structural differences compared to the other six regions, with the highest relative abundances of Chloroflexi and Acidobacteriota. In contrast, the highest relative abundance of Proteobacteria is found in Honghe Shiping (SP), while Actinobacteriota has the highest relative abundance in Yuxi Xinping (XP). RDA analysis indicates that soil nutrients (SOM, pH, AP, TN) affect the water content, soluble sugar, and crude fat of bamboo shoots. Additionally, the bacterial communities including Actinobacteriota, Chloroflexi, Patescibacteria, GAL15, and Cyanobacteria influence the water content, soluble sugar, ash content, protein, and lignin of bamboo shoots. Discussion In the fungal community, Basidiomycota, Kickxellomycota, Mucoromycota, unclassified-k-Fungi, and Glomeromycota affect the water content and tannin levels in bamboo shoots. In summary, soil nutrients and soil microorganisms are interconnected and work together to influence the quality of bamboo shoots.

Chen, Qian↗
DOE OSTI2012

Comparative Genomics of Early-Diverging Brucella Strains Reveals a Novel Lipopolysaccharide Biosynthesis Pathway

Abstract: Brucella species are Gram-negative bacteria that infect mammals. Recently, two unusual strains (Brucella inopinata BO1 T and B. inopinata-like BO2) have been isolated from human patients, and their similarity to some atypical brucellae isolated from Australian native rodent species was noted. Here we present a phylogenomic analysis of the draft genome sequences of BO1 T and BO2 and of the Australian rodent strains 83-13 and NF2653 that shows that they form two groups well separated from the other sequenced Brucella spp. Several important differences were noted. Both BO1 T and BO2 did not agglutinate significantly when live or inactivated cells were exposed to monospecific A andMantisera against O-side chain sugars composed of N-formyl-perosamine. While BO1 T maintained the genes required to synthesize a typical Brucella O-antigen, BO2 lacked many of these genes but still produced a smooth LPS (lipopolysaccharide). Most missing genes were found in the wbk region involved in O-antigen synthesis in classic smooth Brucella spp. In their place, BO2 carries four genes that other bacteria use for making a rhamnose-based O-antigen. Electrophoretic, immunoblot, and chemical analyses showed that BO2 carries an antigenically different O-antigen made of repeating hexose-rich oligosaccharide units that made the LPS water-soluble, which contrasts with the homopolymeric O-antigen of other smooth brucellae that have a phenol-soluble LPS. The results demonstrate the existence of a group of early-diverging brucellae with traits that depart significantly from those of the Brucella species described thus far. Importance: This report examines differences between genomes from four new Brucella strains and those from the classic Brucella spp. Our results show that the four new strains are outliers with respect to the previously known Brucella strains and yet are part of the genus, forming two new clades. The analysis revealed important information about the evolution and survival mechanisms of Brucella species, helping reshape our knowledge of this important zoonotic pathogen. One discovery of special importance is that one of the strains, BO2, produces an O-antigen distinct from any that has been seen in any other Brucella isolates to date.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

High throughput, accurate gene annotation through AI and HPC-enabled structural analysis

With the advances in next generation sequencing technologies, the number of sequenced genomes is growing exponentially, resulting in a technology bottleneck for the translation of sequence information into usable hypotheses about the function of each gene. We have proposed leveraging our leadership high-performance computing (HPC) resources to help break this annotation bottleneck. Here we design an HPC-based framework to infer gene function from gene sequence by incorporating information about protein structure and interactions predicted by deep learning approaches. Accurate functional prediction and gene annotation using computational methods will facilitate breakthroughs in the genomic sciences essential to understanding and harnessing life processes in bacteria, fungi and plants. The development and applications of the state-of-the-art deep neural networks to protein structural modeling, interaction prediction, sequence comparison, and quality assessment of protein structural models will be made possible by leadership computational resources. These HPC-enabled bioinformatics and molecular modeling tools will provide powerful insights into molecular functions of genes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Delayed access to feed early post-hatch affects the development and maturation of gastrointestinal tract microbiota in broiler chickens

Background: The first two weeks of post-hatch (PH) growth in broilers (meat-type birds) are critical for gut development and microbiota colonization. In the current broiler production system, chicks may not receive feed and water for 24 to 72 h due to variations in hatching time and hatchery management. Post-hatch feed delay affects body weight, feed efficiency, mortality, and gut development. The goal of this study was to investigate changes in the microbiome in broiler chickens early PH and the effect of delayed access to feed on the microbiota. Results: Chicks either received feed and water immediately after hatch or access to feed was delayed for 48 h to mimic commercial hatchery settings (treatment, TRT). Both groups were sampled (n = 6) at -48, 0, 4 h, and 1 (24 h), 2 (48 h), 3 (72 h), 4 (96 h), 6 (144 h), 8 (192 h), 10 (240 h), 12 (288 h) and 14 (336 h) days PH. Ileal (IL) and cecal (CE) epithelial scrapings (mucosal bacteria, M) and digesta (luminal bacteria, L) were collected for microbiota analysis. Microbiota was determined by sequencing the V3-V4 region of bacterial 16S rRNA and analyzed using QIIME2. The microbiota of early ileal and cecal samples were characterized by high abundance of unclassified bacteria. Among four bacterial populations (IL-L, IL-M, CE-L, CE-M), IL-M was the least affected by delayed access to feed early PH. Both alpha and beta diversities were affected by delayed access to feed PH in IL-L, CE-M and CE-L. However, the development effect was more pronounced. In all four bacterial populations, significant changes due to developmental effect (time relative to hatch) was observed in taxonomic composition, with transient changes of bacterial taxa during the first two weeks PH. Delayed access to feed has limited influence on bacterial composition with only a few genera and species affected in all four bacterial populations. Predicted function based on 16S rRNA was also affected by delayed access to feed PH with most changes in metabolic pathway richness observed in IL-L, CE-L and CE-M. Conclusions: These results show transient changes in chicken microbiota biodiversity during the first two weeks PH and indicate that delayed access to feed affects microbiota development. Proper microbiota development could be an important factor in disease prevention and antibiotic use in broiler chickens. Moreover, significant differences in response to delayed access to feed PH between luminal and mucosal bacterial populations strongly suggests the need for separate analysis of these two populations.

16S↗
NASA NTRS2017

Development of Solid-State Nanopore Technology for Life Detection

Biomarkers for life on Earth are an important starting point to guide the search for life elsewhere. However, the search for life beyond Earth should incorporate technologies capable of recognizing an array of potential biomarkers beyond what we see on Earth, in order to minimize the risk of false negatives from life detection missions. With this in mind, charged linear polymers may be a universal signature for life, due to their ability to store information while also inherently reducing the tendency of complex tertiary structure formation that significantly inhibit replication. Thus, these molecules are attractive targets for biosignature detection as potential "self-sustaining chemical signatures." Examples of charged linear polymers, or polyelectrolytes, include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) as well as synthetic polyelectrolytes that could potentially support life, including threose nucleic acid (TNA) and other xenonucleic acids (XNAs). Nanopore analysis is a novel technology that has been developed for singlemolecule sequencing with exquisite single nucleotide resolution which is also well-suited for analysis of polyelectrolyte molecules. Nanopore analysis has the ability to detect repeating sequences of electrical charges in organic linear polymers, and it is not molecule- specific (i.e. it is not restricted to only DNA or RNA). In this sense, it is a better life detection technique than approaches that are based on specific molecules, such as the polymerase chain reaction (PCR), which requires that the molecule being detected be composed of DNA.

Bywaters, K. B.↗
DOE OSTI2017

On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

60 APPLIED LIFE SCIENCES↗