SEARCH · Engineering Papers

Results for “conservative”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 991 records · Page 55

All sources NASA NTRS DOE OSTI

DOE OSTI2022

Doubling protected land area may be inefficient at preserving the extent of undeveloped land and could cause substantial regional shifts in land use

Abstract Projection of land use and land‐cover change is highly uncertain yet drives critical estimates of carbon emissions, climate change, and food and bioenergy production. We use new, spatially explicit land availability data in conjunction with a model sensitivity analysis to estimate the effects of additional land protection on land use and land cover. The land availability data include protected land and agricultural suitability and is incorporated into the Moirai land data system for initializing the Global Change Analysis Model. Overall, decreasing land availability is relatively inefficient at preserving undeveloped land while having considerable regional land‐use impacts. Current amounts of protected area have little effect on land and crop production estimates, but including the spatial distribution of unsuitable (i.e., unavailable) land dramatically shifts bioenergy production from high northern latitudes to the rest of the world, compared with uniform availability. This highlights the importance of spatial heterogeneity in understanding and managing land change. Approximately doubling the current protected area to emulate a 30% protected area target may avoid land conversion by 2050 of less than half the newly protected extent while reducing bioenergy feedstock land by 10.4% and cropland and grazed pasture by over 3%. Regional bioenergy land may be reduced (increased) by up to 46% (36%), cropland reduced by up to 61%, pasture reduced by up to 100%, and harvested forest reduced by up to 35%. Only a few regions show notable gains in some undeveloped land types of up to 36%. Half of the regions can reach the target using only unsuitable land, which would minimize impacts on agriculture but may not meet conservation goals. Rather than focusing on an area target, a more robust approach may be to carefully select newly protected land to meet well‐defined conservation goals while minimizing impacts to agriculture.

54 ENVIRONMENTAL SCIENCES↗

DOE OSTI2020

A Data-driven Approach for Predicting Nepheline Crystallization in High-Level Waste Glasses

High-level waste (HLW) glasses with high aluminum content are prone to nepheline crystallization during the slow canister cooling that is experienced during large-scale production. Due to its detrimental effects on glass durability, nepheline precipitation must be avoided; however, developing robust, predictive models for nepheline crystallization behavior in HLW glasses is difficult due to their compositional complexity. Using overly conservative constraints to predict nepheline formation can limit the waste loading to lower than the achievable capacity. In this study, a robust data-driven model using five compositional features has been developed to predict nepheline formation. The analysis of the model and the data show that there is an overlap, instead of a distinct compositional boundary, between glasses that form and do not form nepheline. As a result, the model’s predictive accuracy is not the same throughout the feature space and instead is dependent on the location of the glass composition in the dimensionally reduced feature space.

Sargin, Irmak↗

DOE OSTI2021

Predicting nepheline precipitation in waste glasses using ternary submixture model and machine learning

Nepheline precipitation in nuclear waste glasses during vitrification can be detrimental due to its negative effect on chemical durability. Developing models to accurately predict nepheline precipitation from compositions is important to increase waste loading since existing models can be overly conservative. In this study, an expanded dataset containing 955 glasses was compiled from literature data, where 355 glasses are for high-level waste (HLW). Previously developed submixture models were refitted using the new dataset, where a misclassification rate of 7.8% was achieved. Nine machine learning (ML) algorithms (e.g., k-nearest neighbor, Gaussian process regression, artificial neural network, support vector machine, decision tree, etc.) were applied to evaluate their ability of predicting nepheline precipitation from compositions. Model accuracy, precision, recall/sensitivity, and F1 score were systemically compared between different ML algorithms and modeling protocols. Good model prediction with an accuracy ~0.9 (misclassification rate of ~10%) was observed with different algorithms under certain protocol. This study evaluated various ML models to predict nepheline precipitations in waste glasses, highlighting the importance of data preparation, modeling protocol, and their effect on model stability and reproducibility. The results provide insights into applying ML to predict glass properties and suggest areas for future research on modeling nepheline precipitations.

Lu, Xiaonan↗

DOE OSTI2024

Effects of human presence on African mammal waterhole attendance and temporal activity patterns

Abstract Human impacts on the environment and wildlife populations are increasing globally, threatening thousands of species with extinction. While wildlife‐based tourism is beneficial for educating tourists, generating income for conservation efforts, and providing local employment, more information is needed to understand how this industry may impact wildlife. In this study, we used motion‐activated cameras at 12 waterholes on a private game reserve in northern Namibia to determine if the presence of humans and permanent infrastructure affected mammal visits by examining their (1) number of visits, (2) time spent, and (3) diel activity patterns. Our results revealed no differences in the number of visits based on human presence for any of the 17 mammal species studied. However, giraffes ( Giraffe camelopardalis ) spent more time at waterholes before observer presence compared to during. Additionally, several species changed diel activity patterns when human observers were present. Notably, several carnivore and ungulate species increased overlap in their activity patterns during periods while humans were present relative to when humans were absent. These modifications of mammal temporal activity patterns due to human presence could eventually lead to changes in community structure and trophic dynamics because of altered predator–prey interactions. As humans continue to expand into wildlife habitats, and wildlife‐based tourism increases globally, it is imperative that we fully understand the effects of anthropogenic pressures on mammal behavior. Monitoring of wildlife behavioral changes in response to human activity is crucial to further develop wildlife tourism opportunities in a way that optimizes the impact of conservation goals.

Patterson, J. R. [Savannah River Ecology Lab, Warn↗

DOE OSTI2023

Spray‐induced gene silencing to identify powdery mildew gene targets and processes for powdery mildew control

Abstract Spray‐induced gene silencing (SIGS) is an emerging tool for crop pest protection. It utilizes exogenously applied double‐stranded RNA to specifically reduce pest target gene expression using endogenous RNA interference machinery. In this study, SIGS methods were developed and optimized for powdery mildew fungi, which are widespread obligate biotrophic fungi that infect agricultural crops, using the known azole‐fungicide target cytochrome P450 51 (CYP51) in the Golovinomyces orontii–Arabidopsis thaliana pathosystem. Additional screening resulted in the identification of conserved gene targets and processes important to powdery mildew proliferation: apoptosis‐antagonizing transcription factor in essential cellular metabolism and stress response; lipid catabolism genes lipase a , lipase 1 , and acetyl‐CoA oxidase in energy production ; and genes involved in manipulation of the plant host via abscisic acid metabolism ( 9‐cis‐epoxycarotenoid dioxygenase , xanthoxin dehydrogenase , and a putative abscisic acid G‐protein coupled receptor ) and secretion of the effector protein, effector candidate 2 . Powdery mildew is the dominant disease impacting grapes and extensive powdery mildew resistance to applied fungicides has been reported. We therefore developed SIGS for the Erysiphe necator–Vitis vinifera system and tested six successful targets identified using the G. orontii–A. thaliana system. For all targets tested, a similar reduction in powdery mildew disease was observed between systems. This indicates screening of broadly conserved targets in the G. orontii–A. thaliana pathosystem identifies targets and processes for the successful control of other powdery mildew fungi. The efficacy of SIGS on powdery mildew fungi makes SIGS an exciting prospect for commercial powdery mildew control.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

Plant carbohydrate storage: intra- and inter-specific trade-offs reveal a major life history trait

Trade-offs among carbon sinks constrain how trees physiologically, ecologically, and evolutionarily respond to their environments. These trade-offs typically fall along a productive growth to conservative, bet-hedging continuum. How nonstructural carbohydrates (NSCs) stored in living tree cells (known as carbon stores) fit in this trade-off framework is not well understood. Here, we examined relationships between growth and storage using both within species genetic variation from a common garden, and across species phenotypic variation from a global database. We demonstrate that storage is actively accumulated, as part of a conservative, bet-hedging life history strategy. Storage accumulates at the expense of growth both within and across species. Within the species Populus trichocarpa, genetic trade-offs show that for each additional unit of wood area growth (in cm 2 yr –1 ) that genotypes invest in, they lose 1.2 to 1.7 units (mg g –1 NSC) of storage. Across species, for each additional unit of area growth (in cm 2 yr –1 ), trees, on average, reduce their storage by 9.5% in stems and 10.4% in roots. Our findings impact our understanding of basic plant biology, fit storage into a widely used growth-survival trade-off spectrum describing life history strategy, and challenges the assumptions of passive storage made in ecosystem models today.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2025

Rooting for function: community‐level fine‐root traits relate to many ecosystem functions

Humans are driving biodiversity change, which also alters community functional traits. However, how changes in the functional traits of the community alter ecosystem functions—especially belowground—remains an important gap in our understanding of the consequences of biodiversity change. We test hypotheses for how the root traits of the root economics space (composed of the collaboration and conservation gradients) are associated with proxies for ecosystem functioning across grassland and forest ecosystems in both observational and experimental datasets from 810 plant communities. First, we assessed whether community-weighted means of the root economics space traits adhered to the same trade-offs as species-level root traits. Then, we examined the relationships between community-weighted mean root traits and aboveground biomass production, root standing biomass, soil fauna biomass, soil microbial biomass, decomposition of standard and plot-specific material, ammonification, nitrification, phosphatase activity, and drought resistance. We found evidence for a community collaboration gradient but not for a community conservation gradient. Yet, links between community root traits and ecosystem functions were more common than we expected, especially for aboveground biomass, microbial biomass, and decomposition. These findings suggest that changes in species composition, which alter root trait means, will in turn affect critical ecosystem functions.

54 ENVIRONMENTAL SCIENCES↗

DOE OSTI2026

Structure and sequence evolution in the pennycress ( Thlaspi arvense ) pangenome

Eukaryotic genomes harbor many forms of variation, including nucleotide diversity and structural polymorphisms, which experience natural selection and contribute to genome evolution and biodiversity. Harnessing this variation for agriculture hinges on our ability to detect, quantify, catalog, and deploy genetic diversity. Here, we explore seven complete genomes of the emerging biofuel crop pennycress ( Thlaspi arvense ) drawn from across the species' current genetic diversity to catalog variation in genome structure and content. Across this new pangenome resource, we find contrasting evolutionary modes in different genomic zones. Gene-poor, repeat-rich pericentromeric regions experience frequent rearrangements, including repeated centromere repositioning. By contrast, conserved gene-dense chromosome arms maintain large-scale synteny across accessions even in fast-evolving NOD-like receptor immune genes, where microsynteny breaks down across species, but gene cluster positioning macrosynteny is maintained. Our findings highlight that multiple elements of the genome experience dynamic evolution that conserves functional content on the chromosome scale but allows repositioning and presence–absence variation on a local scale. This diversity is invisible to classical reference-based strategies and highlights the strength and utility of pangenomic resources. These results provide a valuable case study of rapid genomic structural evolution within a species and powerful resources for crop development in an emerging biofuel crop.

Thlaspi arvense↗

DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2021

Future roots for future soils

Abstract Mechanical impedance constrains root growth in most soils. Crop cultivation changed the impedance characteristics of native soils, through topsoil erosion, loss of organic matter, disruption of soil structure and loss of biopores. Increasing adoption of Conservation Agriculture in high‐input agroecosystems is returning cultivated soils to the soil impedance characteristics of native soils, but in the low‐input agroecosystems characteristic of developing nations, ongoing soil degradation is generating more challenging environments for root growth. We propose that root phenotypes have evolved to adapt to the altered impedance characteristics of cultivated soil during crop domestication. The diverging trajectories of soils under Conservation Agriculture and low‐input agroecosystems have implications for strategies to develop crops to meet global needs under climate change. We present several root ideotypes as breeding targets under the impedance regimes of both high‐input and low‐input agroecosystems, as well as a set of root phenotypes that should be useful in both scenarios. We argue that a ‘whole plant in whole soil’ perspective will be useful in guiding the development of future crops for future soils.

Lynch, Jonathan P.↗

DOE OSTI2022

Adaptive management of large-scale ecosystem restoration: increasing certainty of habitat outcomes in the Columbia River Estuary, U.S.A.

Ecological restoration programs in dynamic coastal environments can benefit from adaptive management, including an iterative process for identifying and addressing critical uncertainties. We highlight key developments under the three pillars that have increased the rate of restoration by the Columbia Estuary Ecosystem Restoration Program (CEERP) over 20 years: science, coordination, and management. We show how such programs can be institutionalized to ensure that estuary ecosystems are better understood, conserved, and restored. The principal conservation effort under CEERP is to reconnect historical floodplain wetlands to the mainstem. The program also supports other restoration actions that demonstrate a high potential to benefit ecosystem function and endangered salmon populations, however, there is greater uncertainty regarding these less-utilized techniques. Through adaptive management, we address both technical uncertainty regarding benefits to the environmental resource and programmatic uncertainty pertaining to decision-making. Here, we examine three periods of CEERP growth to establish how complementary research and restoration actions have improved program outcomes over time. We highlight the tools and processes that were developed and integrated into the program to refine program strategy, improve project design, and maximize ecological benefits. CEERP supported 77 restoration projects and reconnected over 7,000 acres of floodplain habitat to the lower Columbia River between 2004 and 2021. Building on these successes, we outline current plans to better engage landowners and local communities, solicit new project types, and maintain enough flexibility within the program to adapt to new priorities.

54 ENVIRONMENTAL SCIENCES↗

DOE OSTI2021

The UPR regulator IRE1 promotes balanced organ development by restricting TOR-dependent control of cellular differentiation in Arabidopsis

Proteostasis of the endoplasmic reticulum (ER) is controlled by sophisticated signaling pathways that are collectively called the unfolded protein response (UPR) and are initiated by specialized ER membrane-associated sensors. The evidence that complete loss-of-function mutations of the most conserved of the UPR sensors, inositol-requiring enzyme 1 (IRE1), dysregulates tissue growth and development in metazoans and plants raises the fundamental question as to how IRE1 is connected to organismal growth. To address this question, we interrogated the Arabidopsis primary root, an established model for organ development, using the tractable Arabidopsis IRE1 mutant ire1a ire1b, which has marked root development defects in the absence of exogenous stress. We demonstrate that IRE1 is required to reach maximum rates of cell elongation and root growth. We also established that in the actively growing ire1a ire1b mutant root tips the Target of Rapamycin (TOR) kinase, a widely conserved pro-growth regulator, is hyperactive, and that, unlike cell proliferation, the rate of cell differentiation is enhanced in ire1a ire1b in a TOR-dependent manner. By functionally connecting two essential growth regulators, these results underpin a novel and critical role of IRE1 in organ development and indicate that, as cells exit an undifferentiated state, IRE1 is required to monitor TOR activity to balance cell expansion and maturation during organ biogenesis.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2024

AtDGCR14L contributes to salt-stress tolerance via regulating pre-mRNA splicing in Arabidopsis

In plants, the pre-mRNA alternative splicing has been demonstrated to be a crucial tier that regulates gene expression in response to salt stress. However, the underlying mechanisms remain elusive. Here, in this study, we studied the roles of DIGEORGE-SYNDROME CRITICAL REGION 14-like (AtDGCR14L) in regulating pre-mRNA splicing and salt stress tolerance. We discovered that Arabidopsis AtDGCR14L is required for maintaining plant salt stress tolerance and the constitutively spliced and active isoforms of important stress- and/or abscisic acid (ABA)-responsive genes. We also identified the interaction between AtDGCR14L and splicing factor U1-70k, which needs a highly conserved three amino acid (TWG) motif in DGCR14. Different from wild-type AtDGCR14L, the overexpression of TWG-substituted AtDGCR14L mutant did not change salt stress tolerance or pre-mRNA splicing of stress/ABA-responsive genes. Additionally, SWITCH3A (SWI3A) is a core subunit of the SWI/SUCROSE NONFERMENTING (SWI/SNF) chromatin-remodeling complexes. We found that SWI3A, whose splicing depends on AtDGCR14L, actively enhances salt stress tolerance. These results revealed that AtDGCR14L may play an essential role in crosstalk between plant salt-stress response and pre-mRNA splicing mechanisms. We also unveiled the potential role of SWI3A in controlling salt stress tolerance. The TWG motif in the intrinsically disordered region of AtDGCR14L is highly conserved and crucial for DGCR14 functions.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

Influence of Photovoltaic Shading on Rooftop Heat Transfer, Building Energy Loads, and Photovoltaic Power Output

Photovoltaic (PV) modules on building rooftops provide shade from summer heating, leading to a reduction in cooling load during hot seasons. However, PV shading also reduces passive solar heating during winter months, leading to an increase in the building heating load during cold seasons. In this study, the heat transfer performance of an enclosure formed by adjacent PV modules is analyzed for three locations in the United States, comparing the daily heat flux through rooftops for the case of a PV-shaded rooftop as well as an unshaded roof. Several result metrics are developed as part of this work, including the saved energy load (SEL), or the energy conserved by adding PV-shading to the rooftop, and the additional energy load (AEL), or the supplemental building energy required to replace shaded solar heating. Lastly, this work calculates the utility factor, being the ratio of SEL and PV power output to AEL as a metric of PV effectiveness. SELs are 5.2, 6.2, and 11.7 kWh/m 2 · year for Dayton, Boise, and Phoenix, respectively, while the AELs for the same locations are 1.6, 1.5, and 2.1 kWh/m 2 · year. The utility factors for the same three locations are 61, 71, and 79. In general, locations with hot, non-cloudy summers and clear skies in winter see the largest utility factor. Further, it is shown that PV shading can conserve building energy during the winter months by preventing radiative losses to cold winter skies.

13 HYDRO ENERGY↗

DOE OSTI2023

Quasi-Steady Simulation of Glaze Ice Accretion and Heat Transfer in the Supercooled Large Droplet Regime in Atmospheric Turbulent Air Flow

Abstract To avoid the use of a computationally intensive full unsteady simulation while providing an accurate solution, a quasi-steady simulation has been performed to study glaze and mixed ice accretion in the supercooled large droplet (SLD) regime in turbulent flow of atmospheric air. We have attempted to find the minimum time-step necessary to adequately simulate the icing process on an airfoil surface. Based on node displacement, a mesh morphing scheme has been adopted in the computations to account for the moving boundaries that are caused by the continuous ice buildup. We have modeled ice accretion on an airfoil surface for a time period of 232 s using several time steps. At each time-step we solved the steady-state conservation equations for the air and droplet phases and then used the results as initial conditions for the next time position. The magnitude of the time-step ranged from a least accurate two-shot simulation (where the time-step is 116 s) to a most accurate 2320-shot simulation (where the time-step is 0.1 s). In-between these two extreme time steps, we have performed a three-shot simulation (where the time-step is 77.33 s), a four-shot simulation (where the time-step is 58 s), a six-shot simulation (where the time-step is 38.67 s), a 46-shot simulation (where the time-step is 5 s), and a 232-shot simulation (where the time-step is 1 s). We have done so to find out the degree of accuracy (or inaccuracy) of the multishot simulation approach and to find out the appropriate time-step needed for a successful and valid quasi-steady simulation. A valid quasi-steady simulation needs to use a time-step that is small enough to reproduce the full time-dependent solution within a very small error band. We have found that both the 1 s and the 0.1 s time steps produce virtually identical results. This is the primary litmus test that proves the validity of the quasi-steady-state assumption. The results adopted in this paper are thus all based on the more conservative 0.1 s time-step. In the process of performing the simulations, remeshing was required in order to maintain the grid density in zones of high curvature to be able to capture the full physics in those zones. After successfully modeling glaze ice accretion over the airfoil surface using the 0.1 s quasi-steady simulation approach, the effects of supercooled large droplets (SLDs) impacting the surface have been examined and presented in terms of the variation of the local collection efficiency, the water film thickness, and the heat transfer rate. Examination of the variation of the angle that the ice horn makes with the airfoil chord line demonstrated a 20% improvement in angle prediction when the time-step is reduced from 116 s to 0.1 s. The analysis also reveals a 12% or 8.5% increase in the maximum collection efficiency, βmax, depending on whether the value of the liquid water content (LWC) has been doubled from 0.5 g/m3 to 1 g/m3, or the value of the freestream velocity has been doubled from 75 m/s to 150 m/s, respectively. Because of the need to monitor the local collection efficiency and convective heat fluxes at each shot (regardless of the number of shots employed), the approach adopted here was found to be effective in successively and successfully reproducing the curvature of the glaze ice horn.

Engineering↗

DOE OSTI2025

A Combined Computational and Mathematical Analysis of Interconnect Fatigue Potential in Photovoltaic Modules

A finite element model of a 60-cell monocrystalline silicon glass-polymer photovoltaic module was simulated with ±1.0 kPa and ±2.4 kPa loads applied to the glass to calculate the deformation under load. Cell-to-cell displacements were used to approximate interconnect strain and stress. A mathematical fatigue cycle life relation was fitted to data for the interconnect material (copper), to generate a life prediction at each interconnect location based on the local stress means, reversal extents, and amplitudes. Interconnect stress was found to be significantly asymmetric about zero despite symmetric positive and negative module loads due to laminate thickness offsets about the neutral plane and the effects of module framing. Cycle life results indicated that interconnect fatigue failure was unlikely to occur over a 30-year lifetime of conservative wind and snow load cycles since the typical cell design feature of leaving some unconstrained length between the cell edge and first solder pad increases the effective gauge length and decreases the stress levels below the material endurance limit. Follow-up analyses found that 3.6 mm and 6.4 mm were the minimum unconstrained lengths required to survive the assumed lifetime of wind and snow cycles, respectively, confirming that typical industrial module constructions with 8–15 mm unconstrained lengths should survive conservatively. Notably, large magnitude, low-cycle snow loading was consistently the limiting factor requiring a longer unconstrained interconnect length. Finally, insights and workflows from this study inform module interconnection design limits for survival against mechanical fatigue in deployment environments.

14 SOLAR ENERGY↗

DOE OSTI2020

Implications of Non-Bingham Rheology

One of the key challenges now facing the US Department of Energy (DOE) is the fate of radioactive waste remaining from World War II and the Cold War which is stored underground in tanks some 75 feet in diameter and over 30 feet tall. Over time, the waste has segmented into multiple layers with sludges and slurries at the bottom with salt crust layers often at the top and liquid in between. DOE’s current official baseline plans call for remaining sludges and slurries to be removed from the tanks and converted into a more stable glass waste form. Minimizing worker exposure to radiation drives DOE to use slurry processing techniques to suspend, mobilize, transport, mix, and process the waste. Therefore, a clear and quantitative understanding of Hanford waste rheology is essential for the success of the DOE mission. Historically much of the waste has been characterized using Eugene Bingham’s model more than a century old that provides a straight line fit to higher shear rate data with the intercept suggesting a yield stress and the slope providing the consistency. Yet, Bingham fits overestimate the shear stress at a given shear rate for low to intermediate shear rates, exactly the range of shear rates typically encountered in pipe flow, where shear rates peak along the pipe wall and vanish in the center. This model produces a fictitious yield stress for some of the wastes that do not exhibit yield phenomena. While over estimating the yield stress may be prudent, safe, and conservative for some applications (e.g., pump sizing to ensure that pumps can handle yield stresses), over estimating the rheology may be inaccurate and non-conservative for other applications (e.g., eroding settled particle beds). Therefore, this paper evaluates the slurry rheology of Hanford and Savannah River wastes using a more modern rheological model that fits the full range of experimental data. Although a bias has been recognized and alternative models proposed, the magnitude of this bias and the implications for tank waste have only been qualitatively suggested. The purpose of this paper is to evaluate quantitatively implications of the poor quality of fit between a Bingham model for rheology and experimental data at modest shear rates. We first demonstrate the magnitude of the bias between the data and the Bingham extrapolation. We then evaluate quantitatively the velocity profile under laminar conditions. This analysis shows that the bias may be large (hundreds of percent or more) at modest shear rates and that modest shear rates dominate pipe velocity profiles.

Rheology, Radioactive waste↗