Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “Engineering, Lasers”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 991 records · Page 55
All sourcesNASA NTRSDOE OSTI
DOE OSTI2024

A Novel Dew Point Meter: Application to the Measurement of the Sulfuric Acid Dew Point for Combustion Flue Gas

Accurate knowledge of acid dew point is essential for industrial and applied combustion applications. Sulfur in the fuel or raw materials is converted to sulfur dioxide (SO2) during combustion, and a portion of the SO2 is oxidized to sulfur trioxide (SO3). The SO3 will react to form H2SO4 vapor when in the presence of water vapor. Even with just trace levels of H2SO4 vapor in the gas phase (1-10 ppm), the dew point can reach 100°C and higher. To avoid acid condensation and the resulting corrosion on heat recovery equipment, plant engineers must ensure that surface temperatures are above the acid dew point, but this decreases the efficiency of thermal energy recovery. Thus, there is a trade-off between minimizing equipment corrosion and maximizing thermal energy recovery, and the acid dew point is a key parameter for this optimization. Commercially available acid dew point meters use electric conductivity sensors. These sensors are known to greatly underestimate the dew point due to their low sensitivity. In addition, no validation testing has been reported for these units and they are often expensive. In this work, we analyze the theory of the sulfuric acid condensation and develop a novel dew point meter based on this analysis. The meter consists of a novel optical instrument that is designed to monitor the slightest appearance of condensation on a hydrophobic window surface as the surface temperature of the window is slowly decreased. In this way, an accurate measurement of the dew point is obtained under a wide range of concentrations. The basis of the instrument is that a collimated beam from a diode laser will generate forward scattered light when the beam encounters surface condensate, and a sophisticated array detector is used to sensitively monitor the onset of light scattering. The measurement procedures are established to rapidly find the acid dew point, while minimizing error. Further, to calibrate the dew point meter we developed a calibration system based on a liquid bubbler that can generate a stable gas flow with a known sulfuric acid dew point. Test results show that the dew point meter can accurately measure acid dew point over a wide range. For H2SO4 vapor concentrations as low as 6 ppm the acid dew point is measured with an error of only ~1°C. To demonstrate the versatility of this instrument, the dew point meter was adapted for use with a high-pressure flow cell to allow for measurements of the dew point of flue gas from pressurized oxy-fuel combustion in a 100 kWth pressurized reactor.

Cheng, Mao↗
DOE OSTI2021

Coupling of a single tin-vacancy center to a photonic crystal cavity in diamond

In this work, we demonstrate optical coupling between a single tin-vacancy (SnV) center in diamond and a free-standing photonic crystal nanobeam cavity. The cavities are fabricated using quasi-isotropic etching and feature experimentally measured quality factors as high as ~11000. We investigate the dependence of a single SnV center's emission by controlling the cavity wavelength using a laser-induced gas desorption technique. Under resonance conditions, we observe an intensity enhancement of the SnV emission by a factor of 12 and a 16-fold reduction of the SnV lifetime. Based on the large enhancement of the SnV emission rate inside the cavity, we estimate the Purcell factor for the SnV zero-phonon line to be 37 and the coupling efficiency of the SnV center to the cavity, the β factor, to be 95%. Our work paves the way for the realization of quantum photonic devices and systems based on efficient photonic interfaces using the SnV color center in diamond.

42 ENGINEERING↗
DOE OSTI2023

Direct-write laser-assisted patterning of form birefringence in wave plates fabricated by glancing-angle deposition

The development of optics that provide spatial control of birefringence could enable better control of laser beam polarization, but available solutions are limited. Here we demonstrate a method to locally modify the birefringence of wave plates fabricated by glancing-angle deposition. The method employs localized melting of the anisotropic microstructure in a vacuum environment to alter the local birefringence. We demonstrate that this process is only possible under high vacuum to avoid trapping air within the melt zone. The direct-write method presented here can be readily utilized for coatings exhibiting form birefringence of virtually any chemical composition, size, and format.

42 ENGINEERING↗
DOE OSTI2024

Proton rings from late-forming ballistic sheath fields

Many laser-driven ion experiments have seen ring-like patterns in the proton angular distribution across a wide array of laser and target parameters. These rings can impede measurement due to the small acceptance angle of detectors and often inhibit potential applications. A myriad of explanations for their formation have been proposed, yet most studies attribute them to some aspect of the laser–plasma interaction. Using 3D particle-in-cell simulations, we show that late-forming strong radial electric fields can arise due to charge separation while the beam is in flight, long after the laser–plasma interaction. These fields can accelerate ions to significant divergences (≈ 10°) as they propagate away from the target. We compare our results to a recent experiment where a high intensity, short pulse laser (I 0 ≈ 10 21 W/cm 2 , τ ≈ 30 fs) was incident upon thin (≈ 1 μm) liquid crystal targets. Our simulations capture all the main features of the experimental results—namely, robust ring formation and larger rings for higher energy protons. In addition, we show that rings do not form for sufficiently short preplasma scale lengths. Finally, we develop a phenomenological model to describe the spatiotemporal structure of the radial electric field and use this to explain the proton rings' energy and preplasma dependencies.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2023

Simulation of a rapid compression machine for evaluation of ignition chemistry and soot formation using gasoline/ethanol blends

Due to the projected decline of demand for gasoline in light duty engines and the advent of ethanol as a green fuel, the use of gasoline/ethanol blend fuels in heavy duty applications are being investigated as they are projected to have lower cost and lower lifecycle green house gas (GHG) emissions. In heavy duty engines, the primary mode of combustion is mixing controlled combustion where wide range of mixture conditions (equivalence ratio) exist. Soot emissions of these fuels in richer conditions are not well understood. The goal of this research is to evaluate some commercially available soot modeling codes for the particulate matter emissions from gasoline/ethanol fuel blends, especially at fuel rich conditions. A Rapid Compression Machine (RCM) is modeled in a three-dimensional numerical simulation using CONVERGE computational software using a reduced chemical kinetic mechanism with SAGE chemistry solver and a RANS k-ϵturbulence model with a sector model including the creviced piston. The creviced piston is used in the experimental setup to reduce boundary layer effects and to maintain a homogeneous core in the reaction cylinder. Computational fluid dynamics simulations are conducted for different gasoline-ethanol fuel blends from E10 (10% ethanol v/v) to E100. The fuel blend is modeled as a surrogate mixture of toluene, iso-octane, n-heptane for gasoline content, and ethanol. The computational results were validated against experimental results using pressure measurements and laser extinction diagnostics. Different soot models are investigated to evaluate their capability of predicting the sooting tendencies of fuel blends, especially in richer conditions experienced during mixing-controlled combustion. The experimental combustion characteristics such as the ignition delay of different blends of fuel are reasonably well predicted. The Particulate Size Mimic (PSM) model accurately predicts the soot generation characteristics of the different fuels, but the Hiroyasu-NSC model falls short in this regard. For accurate prediction of soot with the PSM model, the thermodynamic conditions during combustion must be accurately modeled. While the current computational modeling tools can produce accurate results for the prediction of particulate matter emissions, there is much work to be done in improving our understanding of the underlying fundamental processes.

Energy & Fuels↗
DOE OSTI2022

Laser Additive Manufacturing Process Development for Bismuth Telluride Thermoelectric Material

Thermoelectric generators have strong potential for aerospace and aircraft applications. However, traditional manufacturing methods for thermoelectric devices severely limit device adaptability and consequently marketability. Laser powder bed fusion is an additive manufacturing method which shows promising potential for producing thermoelectric devices. Thermoelectric materials pose unique challenges compared to metals because of low thermal conductivity, brittle fracture characteristics, and irregular powder particle morphologies. Herein, we communicate processing procedures to fabricate thermoelectric parts of Bi 2 Te 3 through laser powder bed fusion. In this study, we identify the successful combination of key process parameters—laser power, scan speed, hatch distance, and powder layer thickness—to achieve high-quality parts in terms of density and physical properties, and we demonstrate the impact of process parameter variation on built part quality. While it cannot exclusively determine part quality, the volumetric energy density is a useful guide in deciding process parameters for thermoelectric materials, and the optimal value is between 9 and 11 J/mm 3 for Bi 2 Te 3 . We demonstrate successful fabrication of different freeform geometries of Bi 2 Te 3 powders. The results suggest it is possible to extend this method more broadly to other semiconductor materials, including thermoelectric power generation materials applicable for space applications.

36 MATERIALS SCIENCE↗
DOE OSTI2021

Frequency comb ptychoscopy

Multiheterodyne techniques using frequency combs—radiation sources whose lines are perfectly evenly-spaced—have revolutionized science. By beating sources with the many lines of a comb, their spectra are recovered. Even so, these approaches are fundamentally limited to probing coherent sources, such as lasers. They are unable to measure most spectra that occur in nature. Here we present frequency comb ptychoscopy, a technique that allows for the spectrum of any complex broadband source to be retrieved using a comb. In this approach, the spectrum is reconstructed by unfolding the simultaneous beating of a source with each comb line. We demonstrate this both theoretically and experimentally, at microwave frequencies. This approach can reconstruct the spectrum of nearly any complex source to high resolution, and the speed, resolution, and generality of this technique will allow chip-scale frequency combs to have an impact in a wide swath of new applications, such as remote sensing and passive spectral imaging.

42 ENGINEERING↗
DOE OSTI2023

Analysis and mitigation of an oscillating background on hybrid complementary metal-oxide semiconductor (hCMOS) imaging sensors at the National Ignition Facility

Nanosecond-gated hybrid complementary metal-oxide semiconductor imaging sensors are a powerful tool for temporally gated and spatially resolved measurements in high energy density science, including inertial confinement fusion, and in laser diagnostics. However, a significant oscillating background excited by photocurrent has been observed in image sequences during testing and in experiments at the National Ignition Facility (NIF). Characterization measurements and simulation results are used to explain the oscillations as the convolution of the pixel-level sensor response with a sensor-wide RLC circuit ringing. Finally, data correction techniques are discussed for NIF diagnostics, and for diagnostics where these techniques cannot be used, a proof-of-principle image correction algorithm is presented.

42 ENGINEERING↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Method of making a distributed optical fiber sensor having enhanced Rayleigh scattering and enhanced temperature stability, and monitoring systems employing same

A method of making an optical fiber sensor device for distributed sensing includes generating a laser beam comprising a plurality of ultrafast pulses, and focusing the laser beam into a core of an optical fiber to form a nanograting structure within the core, wherein the nanograting structure includes a plurality of spaced nanograting elements each extending substantially parallel to a longitudinal axis of optical fiber. Also, an optical fiber sensor device for distributed sensing includes an optical fiber having a longitudinal axis, a core, and a nanograting structure within the core, wherein the nanograting structure includes a plurality of spaced nanograting elements each extending substantially parallel to the longitudinal axis of the optical fiber. Also, a distributed sensing method and system and an energy production system that employs such an optical fiber sensor device.

42 ENGINEERING↗
DOE OSTI2020

System and method for in-process inspection within advanced manufacturing processes

A system and method can include a laser Doppler vibrometer (LDV) in optical communication with a part during manufacturing and a transducer in ultrasonic communication with the part during manufacturing. The system can also include a controller connected to both the LDV and the transducer. The controller may be configured to cause the transducer to vibrate the part during manufacturing at a predetermined frequency and the LDV may be configured to measure one or more mechanical response types of the part during manufacturing based on one or more optical characteristics of a reflected beam. The controller may further be configured to determine whether a defect is present in the part during manufacturing in response to the one or more mechanical response types of the part.

42 ENGINEERING↗
DOE OSTI2021

Performance Analysis of PIConGPU: Particle-in-Cell on GPUs using NVIDIA’s NSight Systems and NSight Compute

PIConGPU, Particle In Cell on GPUs, is an open source simulations framework for plasma and laser-plasma physics used to develop advanced particle accelerators for radiation therapy of cancer, high energy physics and photon science. While PIConGPU has been optimized for at least 5 years to run well on NVIDIA GPU-based clusters, there has been limited exploration by the development team of potential scalability bottlenecks using recently updated and new tools including NVIDIA’s NVProf tool and the brand-new NVIDIA NSight Suite (Systems and Compute) tools. PIConGPU is a highly optimized application that runs production jobs at scale on a system Oak Ridge Leadership Facility’s (OLCF) Summit supercomputer (using the full machine at 4600 nodes; at 98% of GPU utilization on all ~28000 NVIDIA Volta GPUs). PIConGPU has been selected as one of the the eight applications for OLCF’s coveted Center for Accelerated Application Readiness (CAAR) program aimed at the facility’s Frontier supercomputer (OLCF’s first exascale system to launch in 2021), to partner with our vendors (primary vendors: AMD and Cray/HPE) ensuring that Frontier will be able to perform large-scale science when it opens to users in 2022. To this effect, performance engineers on the PIConGPU team wanted to dive deep into the application to understand at the finest granularity, which portions of the code could be further optimized to exploit the hardware on Summit at it’s maximum potential and also to elucidate which key kernels should be tracked and optimized for the CAAR effort to port this code to Frontier. Any bottlenecks that are observed via performance profiling on Summit are likely to also impact scalability on the Frontier-dev system and the Frontier Early Access (EA) system. Additionally, the engineers wanted to take a closer look at the newest NVIDIA profiling tools which allows us to identify the most useful features on these tools and will provide an opportunity to compare it to new AMD and Cray’s performance analysis tool releases and provide feedback to our vendor partners on what features are most important and mission critical for CAAR efforts. The primary goal of this report is to focus on the evaluation of PIConGPU’s most time-intensive kernels using NVProf and NSight Suite. Three kernels, Current Deposition (also known as Compute Current), Particle Push (Move and Mark), and Shift Particles are known to be some of the most time-consuming kernels in PIConGPU. The Current xi Deposition kernel and Particle Push kernel both set up the particle attributes for running any physics simulation with PIConGPU, so it is crucial to improve the performance of these two kernels. In this report, we measure single GPU metrics for the three kernels, offer high level takeaways from the conducted analysis, and compare the profiling data from NSight Compute to that of NVProf. This analysis was performed using a grid size of 240 x 272 x 224, and 10 time steps with the Mid-November Figure of Merit (FOM) run setup. The Traveling Wave Electron Acceleration (TWEAC) science case used in this run is a representative science case for PIConGPU. This execution can also be used for baseline analysis on AMD MI50/ MI60 systems. As of the time of writing, the PIConGPU application has limited use for features of NSight Systems, so this report will mainly focus on insights garnered from NSight Compute. For this analysis, we run the “full” metric set available in NSight Compute version 2020.1.2 and use NSight Systems version 2020.3.1 to generate the application timeline.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2021

Nonequilibrium dynamics of spontaneous symmetry breaking into a hidden state of charge-density wave

Abstract Nonequilibrium phase transitions play a pivotal role in broad physical contexts, from condensed matter to cosmology. Tracking the formation of nonequilibrium phases in condensed matter requires a resolution of the long-range cooperativity on ultra-short timescales. Here, we study the spontaneous transformation of a charge-density wave in CeTe 3 from a stripe order into a bi-directional state inaccessible thermodynamically but is induced by intense laser pulses. With ≈100 fs resolution coherent electron diffraction, we capture the entire course of this transformation and show self-organization that defines a nonthermal critical point, unveiling the nonequilibrium energy landscape. We discuss the generation of instabilities by a swift interaction quench that changes the system symmetry preference, and the phase ordering dynamics orchestrated over a nonadiabatic timescale to allow new order parameter fluctuations to gain long-range correlations. Remarkably, the subsequent thermalization locks the remnants of the transient order into longer-lived topological defects for more than 2 ns.

36 MATERIALS SCIENCE↗
DOE OSTI2022

Controlling process instability for defect lean metal additive manufacturing

The process instabilities intrinsic to the localized laser-powder bed interaction cause the formation of various defects in laser powder bed fusion (LPBF) additive manufacturing process. Particularly, the stochastic formation of large spatters leads to unpredictable defects in the as-printed parts. Here we report the elimination of large spatters through controlling laser-powder bed interaction instabilities by using nanoparticles. The elimination of large spatters results in 3D printing of defect lean sample with good consistency and enhanced properties. We reveal that two mechanisms work synergistically to eliminate all types of large spatters: (1) nanoparticle-enabled control of molten pool fluctuation eliminates the liquid breakup induced large spatters; (2) nanoparticle-enabled control of the liquid droplet coalescence eliminates liquid droplet colliding induced large spatters. The nanoparticle-enabled simultaneous stabilization of molten pool fluctuation and prevention of liquid droplet coalescence discovered here provide a potential way to achieve defect lean metal additive manufacturing.

36 MATERIALS SCIENCE↗
DOE OSTI2020

Near field excited state imaging via stimulated electron energy gain spectroscopy of localized surface plasmon resonances in plasmonic nanorod antennas

Continuous wave (cw) photon stimulated electron energy loss and gain spectroscopy (sEELS and sEEGS) is used to image the near field of optically stimulated localized surface plasmon resonance (LSPR) modes in nanorod antennas. An optical delivery system equipped with a nanomanipulator and a fiber-coupled laser diode is used to simultaneously irradiate plasmonic nanostructures in a (scanning) transmission electron microscope. The nanorod length is varied such that the m = 1, 2, and 3 LSPR modes are resonant with the laser energy and the optically stimulated near field spectra and images of these modes are measured. Various nanorod orientations are also investigated to explore retardation effects. Optical and electron beam simulations are used to rationalize the observed patterns. As expected, the odd modes are optically bright and result in observed sEEG responses. The m = 2 dark mode does not produce a sEEG response, however, when tilted such that retardation effects are operative, the sEEG signal emerges. Thus, we demonstrate that cw sEEGS is an effective tool in imaging the near field of the full set of nanorod plasmon modes of either parity.

36 MATERIALS SCIENCE↗
DOE OSTI2020

THE EFFECT OF FUEL REACTIVITY AND EXHAUST GAS RECIRCULATION ON KNOCK PROPENSITY OF NATURAL GAS

The development of high efficiency, spark ignited natural gas engines is currently limited by engine knock at high compression ratio/elevated boost pressures and misfire at lean conditions/high exhaust gas recirculation (EGR) levels. The knock and misfire limits are further confounded by the wide variety in fuel reactivity observed in “pipeline quality” natural gas. In this study, a rapid compression machine was used to characterize the effects of EGR and variation in natural gas fuel reactivity on the homogeneous ignition delay, flame propagation rate, and end- gas autoignition propensity for stoichiometric natural gas/oxidizer/EGR blends. A reduced chemical kinetic mechanism was also developed to accurately model the homogeneous ignition delays measured in the Colorado State University rapid compression machine (CSU RCM). Pipeline quality natural gas with a range of chemical reactivity (68 < Methane Number < 95) was simulated using mixtures of CH4, C2H6, and C3H8. Exhaust gas recirculation gases were simulated with mixtures of Ar, CO2, CO, and NO at substitution rates of 0 to 30 mass percent. Ignition delay period under homogeneous autoignition conditions was measured at compressed pressures of 30.2 to 34.0 bar and compressed temperatures of 667 to 980 K. End-gas autoignition fraction and flame propagation rate were measured by initiating a laser spark in the center of the combustion chamber, after compression, at pressures of 30.7 to 32.7 bar and temperatures of 751 to 795 K. The results indicate that both fuel reactivity and the presence of reactive species (NO and CO) in the exhaust gas recirculation have a strong impact on end-gas autoignition fraction. A chemical kinetic mechanism was developed to predict homogeneous ignition delays for pipeline quality natural gas in a pressure and temperature range of 1-100 bar and 500-1000 K respectively. This mechanism accurately predicted measured homogeneous ignition delay in the RCM with a total average relative error of 11.0%.

Mohr, Jeffrey↗
DOE OSTI2025

Approaching the Lower Temporal Limit of Laser‐Produced Plasma Sources for Table‐Top Soft X‐Ray NEXAFS Measurements

Abstract The increasing popularity of time‐resolved X‐ray absorption measurements for understanding dynamics in molecular and material systems has led to many advances in table‐top sources for pulsed X‐rays. We report on a table‐top laser‐produced plasma (LPP) source that can perform soft X‐ray (SXR), near‐edge X‐ray absorption fine structure (NEXAFS) measurements using a laser source with 23 ps pulse duration. The spectrometer's key specifications, such as brilliance, resolution, and stability, are characterized against the more commonly used longer‐pulse‐duration LPP sources. The 23 ps laser produced approximately an order of magnitude weaker SXR flux than the 8 ns laser for a higher power density due to the smaller total energy absorbed by the plasma. The increased repetition rate, as well as the use of a high line‐density X‐grating, and a self‐referencing scheme still allowed for NEXAFS measurements of Si 3 N 4 and TiO 2 thin films with 2.5 minute acquisition times, a resolving power of E/ΔE=424, and a signal‐to‐noise ratio of 100. It was observed that degradation of the gas jet nozzle led to long‐term instability of the source, which can be remediated using alternative nozzle designs. This work demonstrates the feasibility of achieving higher temporal resolution in future time‐resolved X‐ray absorption measurements using table‐top LPP sources.

Nimlos, Danika [Division of Chemistry and Chemical↗
DOE OSTI2025

Processability and Material Behavior of NiTi Shape Memory Alloys Using Wire Laser-Directed Energy Deposition (WL-DED)

Utilizing additive manufacturing (AM) techniques with shape memory alloys (SMAs) like NiTi shows great promise for fabricating highly flexible and functionally superior 3D metallic structures. Compared to methods relying on powder feedstocks, wire-based additive manufacturing processes provide a viable alternative, addressing challenges such as chemical composition instability, material availability, higher feedstock costs, and limitations on part size while simplifying process development. This study presented a novel approach by thoroughly assessing the printability of Ni-rich Ni55.94Ti (Wt. %) SMA using the wire laser-directed energy deposition (WL-DED) technique, addressing the existing knowledge gap regarding the laser wire-feed metal additive manufacturing of NiTi alloys. For the first time, the impact of processing parameters—specifically laser power (400–1000 W) and transverse speed (300–900 mm/min)—on single-track fabrication using NiTi wires in the WL-DED process was examined. An optimal range of process parameters was determined to achieve high-quality prints with minimal defects, such as wire dripping, stubbing, and overfilling. Building upon these findings, we printed five distinct cubes, demonstrating the feasibility of producing nearly porosity-free specimens. Notably, this study investigated the effect of energy density on the printed part density, impurity pick-up, transformation temperature, and hardness of the manufactured NiTi cubes. The results from the cube study demonstrated that varying energy densities (46.66–70 J/mm3) significantly affected the quality of the deposits. Lower to intermediate energy densities achieved high relative densities (>99%) and favorable phase transformation temperatures. In contrast, higher energy densities led to instability in melt pool shape, increased porosity, and discrepancies in phase transformation temperatures. These findings highlighted the critical role of precise parameter control in achieving functional NiTi parts and offer valuable insights for advancing AM techniques in fabricating larger high-quality NiTi components. Additionally, our research highlighted important considerations for civil engineering applications, particularly in the development of seismic dampers for energy dissipation in structures, offering a promising solution for enhancing structural performance and energy management in critical infrastructure.

Dabbaghi, Hediyeh↗