Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “SPECIFICATIONS”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5

Modifying Specific Ion Effects: Studies of Monovalent Ion Interactions with Amines

Specific ion effects in the interactions of monovalent anions with amine groups-one of the hydrophilic moieties found in proteins-were investigated using octadecylamine monolayers floating at air–aqueous solution interfaces. Here, we find that at solution pH 5.7, larger monovalent anions induce a nonzero pressure starting at higher areas/molecules, i.e., a wider “liquid expanded” region in the monolayer isotherms. Using X-ray fluorescence at near total reflection (XFNTR), an element- and surface-specific technique, ion adsorption to the amines at pH 5.7 is confirmed to be ion-specific and to follow the conventional Hofmeister series. However, at pH 4, this ion specificity is no longer observed. We propose that at the higher pH, the amine headgroups are only partially protonated, and large polarizable ions such as iodine are better able to boost amine protonation. At the lower pH, on the other hand, the monolayer is fully protonated, and electrostatic interactions dominate over ion specificity. These results demonstrate that ion specificity can be modified by changing the experimental conditions.

36 MATERIALS SCIENCE↗

A spatio-temporally constrained gene regulatory network directed by PBX1/2 acquires limb patterning specificity via HAND2

A lingering question in developmental biology has centered on how transcription factors with widespread distribution in vertebrate embryos can perform tissue-specific functions. Here, using the murine hindlimb as a model, we investigate the elusive mechanisms whereby PBX TALE homeoproteins, viewed primarily as HOX cofactors, attain context-specific developmental roles despite ubiquitous presence in the embryo. We first demonstrate that mesenchymal-specific loss of PBX1/2 or the transcriptional regulator HAND2 generates similar limb phenotypes. By combining tissue-specific and temporally controlled mutagenesis with multi-omics approaches, we reconstruct a gene regulatory network (GRN) at organismal-level resolution that is collaboratively directed by PBX1/2 and HAND2 interactions in subsets of posterior hindlimb mesenchymal cells. Genome-wide profiling of PBX1 binding across multiple embryonic tissues further reveals that HAND2 interacts with subsets of PBX-bound regions to regulate limb-specific GRNs. Our research elucidates fundamental principles by which promiscuous transcription factors cooperate with cofactors that display domain-restricted localization to instruct tissue-specific developmental programs.

59 BASIC BIOLOGICAL SCIENCES↗

Predicting oncology drug-induced cardiotoxicity with donor-specific iPSC-CMs—a proof-of-concept study with doxorubicin

Abstract Many oncology drugs have been found to induce cardiotoxicity in a subset of patients, which significantly limits their clinical use and impedes the benefit of lifesaving anticancer treatments. Human induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) carry donor-specific genetic information and have been proposed for exploring the interindividual difference in oncology drug-induced cardiotoxicity. Herein, we evaluated the inter- and intraindividual variability of iPSC-CM-related assays and presented a proof of concept to prospectively predict doxorubicin (DOX)-induced cardiotoxicity (DIC) using donor-specific iPSC-CMs. Our findings demonstrated that donor-specific iPSC-CMs exhibited greater line-to-line variability than the intraindividual variability in impedance cytotoxicity and transcriptome assays. The variable and dose-dependent cytotoxic responses of iPSC-CMs resembled those observed in clinical practice and largely replicated the reported mechanisms. By categorizing iPSC-CMs into resistant and sensitive cell lines based on their time- and concentration-related phenotypic responses to DOX, we found that the sensitivity of donor-specific iPSC-CMs to DOX may predict in vivo DIC risk. Furthermore, we identified a differentially expressed gene, DND microRNA-mediated repression inhibitor 1 (DND1), between the DOX-resistant and DOX-sensitive iPSC-CMs. Our results support the utilization of donor-specific iPSC-CMs in assessing interindividual differences in DIC. Further studies will encompass a large panel of donor-specific iPSC-CMs to identify potential novel molecular and genetic biomarkers for predicting DOX and other oncology drug-induced cardiotoxicity.

Toxicology↗

Pith–specific lignification in Nicotiana attenuata as a defense against a stem–boring herbivore

Plants have developed tissue-specific defense strategies in response to various herbivores with different feeding habits. Although defense responses to leaf-chewing insects have been well studied, little is known about stem-specific responses, particularly in the pith, to stem-boring herbivores. To understand the stem-specific defense, we first conducted a comparative transcriptomic analysis of the wild tobacco Nicotiana attenuata before and after attack by the leaf-chewing herbivore Manduca sexta and the stem borer Trichobaris mucorea. When the stem-boring herbivore attacked, lignin-associated genes were upregulated specifically in the inner parenchymal cells of the stem, the pith; lignin also accumulated highly in the attacked pith. Silencing the lignin biosynthetic gene cinnamyl alcohol dehydrogenase enhanced the performance of the stem-boring herbivore but had no effect on the growth of the leaf-chewing herbivore. Two-dimensional nuclear magnetic resonance results revealed that lignified pith contains feruloyltyramine as an unusual lignin component in the cell wall, as a response against stem-boring herbivore attack. Pith-specific lignification induced by the stem-boring herbivore was modulated by both jasmonate and ethylene signaling. Furthermore, these results suggest that lignin provides a stem-specific inducible barrier, protecting plants against stem-boring insects.

59 BASIC BIOLOGICAL SCIENCES↗

To image, or not to image: class-specific diffractive cameras with all-optical erasure of undesired objects

Abstract Privacy protection is a growing concern in the digital era, with machine vision techniques widely used throughout public and private settings. Existing methods address this growing problem by, e.g., encrypting camera images or obscuring/blurring the imaged information through digital algorithms. Here, we demonstrate a camera design that performs class-specific imaging of target objects with instantaneous all-optical erasure of other classes of objects. This diffractive camera consists of transmissive surfaces structured using deep learning to perform selective imaging of target classes of objects positioned at its input field-of-view. After their fabrication, the thin diffractive layers collectively perform optical mode filtering to accurately form images of the objects that belong to a target data class or group of classes, while instantaneously erasing objects of the other data classes at the output field-of-view. Using the same framework, we also demonstrate the design of class-specific permutation and class-specific linear transformation cameras, where the objects of a target data class are pixel-wise permuted or linearly transformed following an arbitrarily selected transformation matrix for all-optical class-specific encryption, while the other classes of objects are irreversibly erased from the output image. The success of class-specific diffractive cameras was experimentally demonstrated using terahertz (THz) waves and 3D-printed diffractive layers that selectively imaged only one class of the MNIST handwritten digit dataset, all-optically erasing the other handwritten digits. This diffractive camera design can be scaled to different parts of the electromagnetic spectrum, including, e.g., the visible and infrared wavelengths, to provide transformative opportunities for privacy-preserving digital cameras and task-specific data-efficient imaging.

47 OTHER INSTRUMENTATION↗

Calcium is associated with specific soil organic carbon decomposition products at Blodgett Forest Research Center, Georgetown, California as analysed with scanning transmission X-ray microscopy carbon near-edge X-ray absorption fine structure spectroscopy

This data is from the paper calcium is associated with specific soil organic carbon decomposition products, published in SOIL. DOI: https://doi.org/10.5194/soil-11-381-2025, 2025.This file contains CSVs with spectral data and bulk soil data and there is no specific program required to open this data. The data includes Scanning transmission X-ray microscopy carbon near-edge X-ray absorption fine structure spectroscopy. data from the measurement of samples from the Whole-soil Warming project, run by the Belowground Biogeochemistry team at Blodgett Forest Research Center, Georgetown, California run by the University of California, Berkeley. It also includes bulk soil chemical properties. The University of California's Blodgett Forest Research Station (Forest) is situated in the Sierra Nevada foothills (1370 m a.s.l.) near Georgetown, California. The samples were collected from here: 38.912013, -120.661469, https://maps.app.goo.gl/291bCJ1zVqUhgktz6. The Forest soils were characterised as Alfisols, which are equivalent to Dystric Cambisols (IUSS Working Group WRB, 2015), and formed in granitic parent materials, in a temperate climate, under thinned, mixed-coniferous forest (Fig. S3; Gaudinski et al., 2009). With these analyses we aimed to answer the question, is calcium associated with a specific type of organic matter enriched in aromatic and phenolic carbon at the microscale in samples from Blodgett Forest Research Center? and how does this specific type of carbon respond to experiments targetted at removing and adding calcium to the soils, specifically cation exchange and incubation after calcium addition? Abstract from the paper can be found below: Calcium (Ca) may contribute to the preservation of soil organic carbon (SOC) in more ecosystems than previously thought. Here we provide evidence that Ca is co-located with SOC compounds that are enriched in aromatic and phenolic groups, across different acidic soil-types and locations with different ecosystem properties, differing in terms of climate, parent material, soil type, and vegetation. In turn, this co-localised fraction of Ca-SOC is removed through cation-exchange, and the association is then only re-established during decomposition in the presence of Ca (Ca addition incubation). Thus, highlighting a causative link between decomposition and the co-location of Ca with a characteristic fraction of SOC. Decomposition increases the relative proportion of negatively charged functional groups, which can increase the propensity for the association between SOC and Ca, and in turn, this association inhibits dissolved organic carbon export or further decomposition. We propose that this mechanism could be driven by Ca hotspots on the microscale shifting local decomposition processes and thereby explaining the colocation of Ca with SOC of a specific composition across different acidic soil environments. Incorporating this biogeochemical process into Earth System Models could improve our understanding, predictions, and management of carbon dynamics in soils, and account for their response to Ca-rich amendments.

54 ENVIRONMENTAL SCIENCES↗

Social impact evaluation : Some implications of the specific decisional context approach for anticipatory project assessment with special reference to available alternatives and to techniques of evaluating the social impacts of the anticipated effects of such alternatives

The implications are explored of the specific decision context approach to anticipatory project assessment. More specifically, it is hypothesized that with respect to any given effect of a proposed project or action (mobility, job opportunities, air pollution, population distribution, etc.) such effect will likely differ in probability and/or magnitude from one decisional context to another; that the social desirability or undesirability of a given effect is a function (will differ with) each specific decisional context; that therefore the social impact of such effect will in all likelihood differ with each specific decisional context; and that the social significance of even the dame social impact of a given effect will vary from one decisional context to another when such social impact interacts with (competes with or reinforces) the social impacts of other effects. It also follows from this analysis that the respective roles of scientific method (demonstrable data) and adversarial system will not only differ with each specific decisional context but with each alternative course of action available to the decisional entity in each specific context.

Mayo, L. H.↗

The Hierarchical Specification and Mechanical Verification of the SIFT Design

The formal specification and proof methodology employed to demonstrate that the SIFT computer system meets its requirements are described. The hierarchy of design specifications is shown, from very abstract descriptions of system function down to the implementation. The most abstract design specifications are simple and easy to understand, almost all details of the realization were abstracted out, and are used to ensure that the system functions reliably and as intended. A succession of lower level specifications refines these specifications into more detailed, and more complex, views of the system design, culminating in the Pascal implementation. The section describes the rigorous mechanical proof that the abstract specifications are satisfied by the actual implementation.

Source record↗

Report on the formal specification and partial verification of the VIPER microprocessor

The VIPER microprocessor chip is partitioned into four levels of abstractions. At the highest level, VIPER is described with decreasingly abstract sets of functions in LCF-LSM. At the lowest level are the gate-level models in proprietary CAD languages. The block-level and gate-level specifications are also given in the ELLA simulation language. Among VIPER's deficiencies are the fact that there is no notion of external events in the top-level specification, and it is impossible to use the top-level specifications to prove abstract properties of programs running on VIPER computers. There is no complete proof that the gate-level specifications implement the top-level specifications. Cohn's proof that the major-state machine correctly implements the top-level specifications has no formal connection with any of the other proof attempts. None of the latter address resetting the machine, memory timeout, forced error, or single step modes.

Brock, Bishop↗

mREST Interface Specification

mREST is an implementation of the REST architecture specific to the management and sharing of data in a system of logical elements. The purpose of this document is to clearly define the mREST interface protocol. The interface protocol covers all of the interaction between mREST clients and mREST servers. System-level requirements are not specifically addressed. In an mREST system, there are typically some backend interfaces between a Logical System Element (LSE) and the associated hardware/software system. For example, a network camera LSE would have a backend interface to the camera itself. These interfaces are specific to each type of LSE and are not covered in this document. There are also frontend interfaces that may exist in certain mREST manager applications. For example, an electronic procedure execution application may have a specialized interface for configuring the procedures. This interface would be application specific and outside of this document scope. mREST is intended to be a generic protocol which can be used in a wide variety of applications. A few scenarios are discussed to provide additional clarity but, in general, application-specific implementations of mREST are not specifically addressed. In short, this document is intended to provide all of the information necessary for an application developer to create mREST interface agents. This includes both mREST clients (mREST manager applications) and mREST servers (logical system elements, or LSEs).

McCartney, Patrick↗

3D Printed eutectic aluminum alloy has facility for site-specific properties

Additive manufacturing (AM) has the ability to print structures with site-specific properties. Existing AM approaches for site-specific properties are, however, based on complex processing-microstructure relationships in conventional alloys that were not designed for this purpose. Here, in this work, we report a straightforward approach for achieving site-specific properties that takes advantage of eutectic solidification characteristics. We demonstrate that the yield strength of a eutectic Al-Cu-Ce-Zr alloy can be tuned by varying the laser scan speed in concert with hatch spacing in laser powder bed fusion AM. A faster speed increases solidification rate resulting in finer eutectic spacing and higher strength. The hatch spacing is reduced at faster speeds to ensure overlap between melt pools which become smaller with increasing scan speed. The yield strength and its anisotropy relative to build direction are further tunable with a heat treatment. The scan speed-eutectic spacing-strength relationship is successfully applied to print a complex pattern of site-specific hardness in the alloy. The generalized principle of using AM for a eutectic alloy to create site-specific properties and anisotropy in properties is demonstrated.

36 MATERIALS SCIENCE↗

Novel Cell-Type-Specific Drought-Responsive Proteins in Root Tips of Field-Grown Perennial Switchgrass

The root-tip region of plants, including the root cap, forms the most basal terminal of the root and exhibits a high degree of cellular complexity in terms of morphology, cytological function, and interaction with environmental cues in the soil. Cells in this region follow a developmental trajectory, transitioning from stem cells to meristematic cells, and ultimately to fully differentiated cell types. However, our understanding of root-tip cell-type specific proteomic responses to abiotic stresses, such as drought, particularly under field conditions, remains limited. This study aimed to identify spatially resolved, cell type-specific proteomes in switchgrass (Panicum virgatum) root tips under drought stress. Root tips were collected from seven-year-old, field-grown switchgrass ‘Alamo’ plants excavated under both well-watered and long-term drought conditions. Cell type-specific proteins were identified using laser capture microdissection (LCM) coupled with nanoPOTS (Nanodroplet Processing in One Pot for Trace Samples) and nano-LC-MS proteomics analysis. Five distinct cell types were targeted: (1) cells in the quiescent center and stem cell niche (QuC), (2) protodermal epidermal cells (PEC) in the meristematic zone, (3) epidermal cells in the transition and elongation zones above the root cap (Epi), (4) peripheral root cap cells (PRC), forming 2–3 layers below the PEC and 1–2 layers above the root border cells, and (5) columella root cap cells (Col) comprising of the columella initials and a single underlying layer of cells undergoing active growth. Principal component analysis (PCA) revealed clear separation among the five targeted cell types, confirming distinct proteomic profiles. Proteins predominantly enriched in each cell type were linked to distinct cellular functions, with QuC cells showing involvement in chromosomal behavior, DNA replication, and mitosis—key processes for stem cell niche regulation. Drought stress resulted in alterations of proteostasis, as evidenced by significant decreases in ribosomal proteins and increases in protein synthesis inhibitors. Moreover, drought stress induced unique cell-type–specific proteins involved in phytohormone biosynthesis and signaling pathways, including auxin, cytokinin, and jasmonic acid. In particular, QuC cells were more highly enriched in proteins associated with DNA repair and mitotic processes. Metabolic pathways related to amino acids, carbohydrates, and lipids were differentially affected in a cell-type–dependent manner, whereas general stress-responsive proteins exhibited consistent changes across all five cell types. Overall, this study provides unique spatially resolved, cell-type-specific proteomic profiles in root tips, representing a significant advancement in our understanding of the cellular mechanisms underlying plant responses to drought stress in natural field conditions.

perennial grass↗

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

Design Basis Document / Owner’s Technical Specification for Nitrate Salt Systems in CSP Projects (Final Technical Report)

The number of commercial coal, gas, and nuclear projects built over the past 100 years number in the thousands. As such, there is a large database, available to a wide range of commercial engineering contractors, on proven designs. In essence, unsuccessful designs have, through generations of iterations, been identified and then deleted from further consideration. In contrast, the number of commercial parabolic trough projects using nitrate salt for the thermal storage media is perhaps 60. Further, the number of commercial central receiver projects using nitrate salt as the working fluid is on the order of 20, including estimates for China. Given the relative immaturity of salt technology, and commercial pressures to successfully bid new solar projects into a mature electricity market, solar projects often promise more than has been delivered. The Design Basis Document / Owner’s Technical Specification is a first step in the iteration process. The report describes the successful features of commercial projects, outlines a range equipment and system failures in projects that didn’t operate as intended, and provides a draft set of design changes intended to correct the known problems. The product of the study is 3 volumes of technical material; one volume is on parabolic trough technologies; a second is on central receiver technologies, and the third is on potential design changes to parabolic trough and central receiver projects. The 3 volumes, which total some 590 pages, can be found at https://www.solardynllc.com/csp-plant-technologies. One of the principal topics in the report is the use of functional or prescriptive specifications. Functional specifications describe what the equipment needs to do, consistent with the minimum legal requirements of the local jurisdictions. The details of how this is to be accomplished is developed by the engineering contractor. Prescriptive specifications, which are developed by the Owner, prescribe to the engineering contractor how the functional requirements are to be met. This arrangement ensures that the favorable experience from a previous project is repeated. One example is the design code for the hot salt tank in central receiver projects. The closest design basis is API Standard 650 Welded Steel Tanks for Oil Storage. However, the maximum design temperature in API 650 is 260 °C. As such, solar projects have typically adopted a hybrid Code approach, in which allowable material stresses are taken from ASME Section II Materials. Further, since the tanks experience daily changes in temperature and in (static) pressure, and since portions of the tank can operate at stresses beyond the elastic range, the low cycle fatigue life of the tank is conducted using the rules of Section VIII Division 2. However, in a recent study by NREL, the principal damage mechanism was identified as creep rather than fatigue. Further, design stresses permitted under Section VIII Division 2, corresponding to a fatigue life of 30 years, result in projected creep lifetimes of only 2 to 5 years. An alternate design approach, prescribed by the Owner, would be based on Code sections intended for high temperature service in the creep regime. A candidate is Section III Division 5. Granted, this is a nuclear code section, and it’s use would not likely be mandated by local jurisdictions. However, the effects of creep have been deemed to be of sufficient importance that one nuclear project developer, and one central receiver project developer, have stipulated in the tank design specification that the equipment be designed to the requirements of Section III Division 5.

14 SOLAR ENERGY↗

Removal of Non-Specifically Bound Proteins Using Rayleigh Waves Generated on ST-Quartz Substrates

Label-free biosensors are plagued by the issue of non-specific protein binding which negatively affects sensing parameters such as sensitivity, selectivity, and limit-of-detection. In the current work, we explore the possibility of using the Rayleigh waves in ST-Quartz devices to efficiently remove non-specifically bound proteins via acoustic streaming. A coupled-field finite element (FE) fluid structure interaction (FSI) model of a surface acoustic wave (SAW) device based on ST-Quartz substrate in contact with a liquid loading was first used to predict trends in forces related to SAW-induced acoustic streaming. Based on model predictions, it is found that the computed SAW body force is sufficient to overcome adhesive forces between particles and a surface while lift and drag forces prevent reattachment for a range of SAW frequencies. We further performed experiments to validate the model predictions and observe that the excitation of Rayleigh SAWs removed non-specifically bound (NSB) antigens and antibodies from sensing and non-sensing regions, while rinsing and blocking agents were ineffective. An amplified RF signal applied to the device input disrupted the specific interactions between antigens and their capture antibody as well. ST-quartz allows propagation of Rayleigh and leaky SH-SAW waves in orthogonal directions. Thus, the results reported here could allow integration of three important biosensor functions on a single chip, i.e., removal of non-specific binding, mixing, and sensing in the liquid phase.

59 BASIC BIOLOGICAL SCIENCES↗

SPC-2772 Rev 2 General Build to Print Fabrication Specification for Nuclear Use Items

This specification is for use with Safety Significant structures, systems, and components. The scope is for build to print fabrication including, but not limited to, machining, forming, welding, cutting, assembling, etc. Specific scope and associated requirements will be identified in drawings and/or additional procurement documents. ASME B31 fabrication is not included in the scope of this specification. Any conflict between this specification and referenced Codes and Standards, or any supplementary specifications in the procurement documents requires written clarification from the Contractor prior to proceeding with any work. Any deviation from the procurement documents requires approval by the Contractor with the change request process.

21 - SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLAN↗

SPC-70843 Rev 0 MARVEL Control Drum Actuator Fabrication Specification

Idaho National Laboratory (INL) is developing a microreactor to produce electrical power utilizing a small nuclear core and Stirling engines under the Microreactor Application Research Validation and Evaluation (MARVEL) program. This procurement specification defines the requirements for fabrication of components that make up the control drum (CD) actuators. This specification outlines the requirements for fabrication, acknowledging that specific elements will integrate into final assemblies, while others will be delivered as standalone components. The Subcontractor is not responsible for the CD actuator’s final assembly. Any conflict between this specification and referenced Codes and Standards, or any supplementary specifications in the procurement documents requires written clarification from the Contractor prior to proceeding with any work. Any deviation from the procurement documents requires approval by the Contractor with the change request process.

21 - SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLAN↗

A promising intersection of excited‐state‐specific methods from quantum chemistry and quantum Monte Carlo

Abstract We present a discussion of recent progress in excited‐state‐specific quantum chemistry and quantum Monte Carlo alongside a demonstration of how a combination of methods from these two fields can offer reliably accurate excited state predictions across singly excited, doubly excited, and charge transfer states. Both of these fields have seen important advances supporting excited state simulation in recent years, including the introduction of more effective excited‐state‐specific optimization methods, improved handling of complicated wave function forms, and ways of explicitly balancing the quality of wave functions for ground and excited states. To emphasize the promise that exists at this intersection, we provide demonstrations using a combination of excited‐state‐specific complete active space self‐consistent field theory, selected configuration interaction, and state‐specific variance minimization. These demonstrations show that combining excited‐state‐specific quantum chemistry and variational Monte Carlo can be more reliably accurate than either equation of motion coupled cluster theory or multi‐reference perturbation theory, and that it can offer new clarity in cases where existing high‐level methods do not agree. This article is categorized under: Electronic Structure Theory > Ab Initio Electronic Structure Methods Software > Quantum Chemistry

Otis, Leon↗