SEARCH · Engineering Papers

Results for “GFP expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

82 records · Page 5

All sources NASA NTRS DOE OSTI

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

NASA NTRS1999

Cameleon calcium indicator reports cytoplasmic calcium dynamics in Arabidopsis guard cells

Cytoplasmic free calcium ([Ca2+]cyt) acts as a stimulus-induced second messenger in plant cells and multiple signal transduction pathways regulate [Ca2+]cyt in stomatal guard cells. Measuring [Ca2+]cyt in guard cells has previously required loading of calcium-sensitive dyes using invasive and technically difficult micro-injection techniques. To circumvent these problems, we have constitutively expressed the pH-independent, green fluorescent protein-based calcium indicator yellow cameleon 2.1 in Arabidopsis thaliana (Miyawaki et al. 1999; Proc. Natl. Acad. Sci. USA 96, 2135-2140). This yellow cameleon calcium indicator was expressed in guard cells and accumulated predominantly in the cytoplasm. Fluorescence ratio imaging of yellow cameleon 2.1 allowed time-dependent measurements of [Ca2+]cyt in Arabidopsis guard cells. Application of extracellular calcium or the hormone abscisic acid (ABA) induced repetitive [Ca2+]cyt transients in guard cells. [Ca2+]cyt changes could be semi-quantitatively determined following correction of the calibration procedure for chloroplast autofluorescence. Extracellular calcium induced repetitive [Ca2+]cyt transients with peak values of up to approximately 1.5 microM, whereas ABA-induced [Ca2+]cyt transients had peak values up to approximately 0.6 microM. These values are similar to stimulus-induced [Ca2+]cyt changes previously reported in plant cells using ratiometric dyes or aequorin. In some guard cells perfused with low extracellular KCl concentrations, spontaneous calcium transients were observed. As yellow cameleon 2.1 was expressed in all guard cells, [Ca2+]cyt was measured independently in the two guard cells of single stomates for the first time. ABA-induced, calcium-induced or spontaneous [Ca2+]cyt increases were not necessarily synchronized in the two guard cells. Overall, these data demonstrate that that GFP-based cameleon calcium indicators are suitable to measure [Ca2+]cyt changes in guard cells and enable the pattern of [Ca2+]cyt dynamics to be measured with a high level of reproducibility in Arabidopsis cells. This technical advance in combination with cell biological and molecular genetic approaches will become an invaluable tool in the dissection of plant cell signal transduction pathways.

Non-NASA Center↗

DOE OSTI2022

Identification of new marker genes from plant single‐cell RNA‐seq data using interpretable machine learning methods

Summary An essential step in the analysis of single‐cell RNA sequencing data is to classify cells into specific cell types using marker genes. In this study, we have developed a machine learning pipeline called single‐cell predictive marker (SPmarker) to identify novel cell‐type marker genes in the Arabidopsis root. Unlike traditional approaches, our method uses interpretable machine learning models to select marker genes. We have demonstrated that our method can: assign cell types based on cells that were labelled using published methods; project cell types identified by trajectory analysis from one data set to other data sets; and assign cell types based on internal GFP markers. Using SPmarker, we have identified hundreds of new marker genes that were not identified before. As compared to known marker genes, the new marker genes have more orthologous genes identifiable in the corresponding rice single‐cell clusters. The new root hair marker genes also include 172 genes with orthologs expressed in root hair cells in five non‐ Arabidopsis species, which expands the number of marker genes for this cell type by 35–154%. Our results represent a new approach to identifying cell‐type marker genes from scRNA‐seq data and pave the way for cross‐species mapping of scRNA‐seq data in plants.

54 ENVIRONMENTAL SCIENCES↗

DOE OSTI2025

A non-canonical fungal peroxisome PTS-1 signal, SYM, and its evolutionary aspects

Abstract Proteins localized to peroxisomes, particularly those expressed under specific conditions or in low abundance, are often undetected by routine proteomics methods due to detection sensitivity limits. In silico identification and experimental validation of peroxisomal targeting signals (PTSs) offer a reliable alternative. We demonstrate that SYM, a non-canonical plant PTS-1 signal, functions similarly inAspergillus nidulans, as GFP tagged with a SYM C-terminal tripeptide localizes to peroxisomes. One of two nativeA. nidulansproteins with C-terminal SYM tripeptide shows weak peroxisomal localization alongside cytoplasmic presence, indicating that only a subset of proteins with non-canonical signals access peroxisomes.In silicoanalysis of 1,010 fungal genomes identified diverse SYM-proteins with variable functions, suggesting that non-canonical PTS-1 signals may evolve spontaneously. Two-thirds of SYM-proteins are predicted to localize to specific intracellular compartments other than the peroxisome. We propose that despite their predicted localization, these proteins possessing SYM as a non-canonical peroxisomal signal might also have peroxisomal presence. Among SYM-proteins, pectinesterases, known plant pathogen virulence factors, were frequent. Notably, 25% of fungal pectinesterases harbor non-canonical PTS-1 signals, suggesting that partial peroxisomal localization of pectinesterases has evolved convergently. This suggests that partial peroxisomal localization may enhance protein functional flexibility, contributing to the organism’s adaptability.

Science & Technology - Other Topics↗

NASA NTRS2009

Transgenic Arabidopsis Gene Expression System

The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

Ferl, Robert↗

DOE OSTI2025

Data for Discovery, Characterization, and Application of Chromosomal Integration Sites for Stable Heterologous Gene Expression in Rhodotorula toruloides

Rhodotorula toruloides is a non-model, oleaginous yeast uniquely suited to produce acetyl-CoA-derived chemicals. However, the lack of well-characterized genomic integration sites has impeded the metabolic engineering of this organism. Here we report a set of computationally predicted and experimentally validated chromosomal integration sites in R. toruloides . We first implemented an in silico platform by integrating essential gene information and transcriptomic data to identify candidate sites that meet stringent criteria. We then conducted a full experimental characterization of these sites, assessing integration efficiency, gene expression levels, impact on cell growth, and long-term expression stability. Among the identified sites, 12 exhibited integration efficiencies of 50% or higher, making them sufficient for most metabolic engineering applications. Using selected high-efficiency sites, we achieved simultaneous double and triple integrations and efficiently integrated long functional pathways (up to 14.7 kb). Additionally, we developed a new inducible marker recycling system that allows multiple rounds of integration at our characterized sites. We validated this system by performing five sequential rounds of GFP integration and three sequential rounds of MaFAR integration for fatty alcohol production, demonstrating, for the first time, precise gene copy number tuning in R. toruloides . These characterized integration sites should significantly advance metabolic engineering efforts and future genetic tool development in R. toruloides .

Conversion↗

DOE OSTI2025

Discovery, characterization, and application of chromosomal integration sites for stable heterologous gene expression in Rhodotorula toruloides

Rhodotorula toruloides is a non-model, oleaginous yeast uniquely suited to produce acetyl-CoA-derived chemicals. However, the lack of well-characterized genomic integration sites has impeded the metabolic engineering of this organism. Here we report a set of computationally predicted and experimentally validated chromosomal integration sites in R. toruloides. We first implemented an in silico platform by integrating essential gene information and transcriptomic data to identify candidate sites that meet stringent criteria. We then conducted a full experimental characterization of these sites, assessing integration efficiency, gene expression levels, impact on cell growth, and long-term expression stability. Among the identified sites, 12 exhibited integration efficiencies of 50% or higher, making them sufficient for most metabolic engineering applications. Using selected high-efficiency sites, we achieved simultaneous double and triple integrations and efficiently integrated long functional pathways (up to 14.7 kb). Additionally, we developed a new inducible marker recycling system that allows multiple rounds of integration at our characterized sites. Here, we validated this system by performing five sequential rounds of GFP integration and three sequential rounds of MaFAR integration for fatty alcohol production, demonstrating, for the first time, precise gene copy number tuning in R. toruloides. These characterized integration sites should significantly advance metabolic engineering efforts and future genetic tool development in R. toruloides.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2023

Engineering highly stable variants of Corynactis californica green fluorescent proteins

Fluorescent proteins (FPs) are versatile biomarkers that facilitate effective detection and tracking of macromolecules of interest in real time. Engineered FPs such as superfolder green fluorescent protein (sfGFP) and superfolder Cherry (sfCherry) have exceptional refolding capability capable of delivering fluorescent readout in harsh environments where most proteins lose their native functions. Our recent work on the development of a split FP from a species of strawberry anemone, Corynactis californica, delivered pairs of fragments with up to threefold faster complementation than split GFP. We present the biophysical, biochemical, and structural characteristics of five full-length variants derived from these split C. californica GFP (ccGFP). These ccGFP variants are more tolerant under chemical denaturation with up to 8 kcal/mol lower unfolding free energy than that of the sfGFP. It is likely that some of these ccGFP variants could be suitable as biomarkers under more adverse environments where sfGFP fails to survive. A structural analysis suggests explanations of the variations in stabilities among the ccGFP variants.

59 BASIC BIOLOGICAL SCIENCES↗

NASA NTRS2015

Pioneering a Biobased UAS

With the exponential growth of interest in unmanned aerial vehicles (UAVs) and their vast array of applications in both space exploration and terrestrial uses such as the delivery of medicine and monitoring the environment, the 2014 Stanford-Brown-Spelman iGEM team is pioneering the development of a fully biological UAV for scientific and humanitarian missions. The prospect of a biologically-produced UAV presents numerous advantages over the current manufacturing paradigm. First, a foundational architecture built by cells allows for construction or repair in locations where it would be difficult to bring traditional tools of production. Second, a major limitation of current research with UAVs is the size and high power consumption of analytical instruments, which require bulky electrical components and large fuselages to support their weight. By moving these functions into cells with biosensing capabilities - for example, a series of cells engineered to report GFP, green fluorescent protein, when conditions exceed a certain threshold concentration of a compound of interest, enabling their detection post-flight - these problems of scale can be avoided. To this end, we are working to engineer cells to synthesize cellulose acetate as a novel bioplastic, characterize biological methods of waterproofing the material, and program this material's systemic biodegradation. In addition, we aim to use an "amberless" system to prevent horizontal gene transfer from live cells on the material to microorganisms in the flight environment. So far, we have: successfully transformed Gluconacetobacter hansenii, a cellulose-producing bacterium, with a series of promoters to test transformation efficiency before adding the acetylation genes; isolated protein bands present in the wasp nest material; transformed the cellulose-degrading genes into Escherichia coli; and we have confirmed that the amberless construct prevents protein expression in wild-type cells. In addition, as part of our human outreach project, we have been in touch with leaders in the fields of UAVs, synthetic biology, and earth sciences, and it is clear that biodegradable UAVs could have a significant impact on the industry.

Escherichia↗

NASA NTRS2015

Pioneering a Biobased UAS

With the exponential growth of interest in unmanned aerial vehicles (UAVs) and their vast array of applications in both space exploration and terrestrial uses such as the delivery of medicine and monitoring the environment, the 2014 Stanford-Brown-Spelman iGEM team is pioneering the development of a fully biological UAV for scientific and humanitarian missions. The prospect of a biologically-produced UAV presents numerous advantages over the current manufacturing paradigm. First, a foundational architecture built by cells allows for construction or repair in locations where it would be difficult to bring traditional tools of production. Second, a major limitation of current research with UAVs is the size and high power consumption of analytical instruments, which require bulky electrical components and large fuselages to support their weight. By moving these functions into cells with biosensing capabilities – for example, a series of cells engineered to report GFP, green fluorescent protein, when conditions exceed a certain threshold concentration of a compound of interest, enabling their detection post-flight – these problems of scale can be avoided. To this end, we are working to engineer cells to synthesize cellulose acetate as a novel bioplastic, characterize biological methods of waterproofing the material, and program this material’s systemic biodegradation. In addition, we aim to use an “amberless” system to prevent horizontal gene transfer from live cells on the material to microorganisms in the flight environment. So far, we have: successfully transformed Gluconacetobacter hansenii, a cellulose-producing bacterium, with a series of promoters to test transformation efficiency before adding the acetylation genes; isolated protein bands present in the wasp nest material; transformed the cellulose-degrading genes into Escherichia coli; and we have confirmed that the amberless construct prevents protein expression in wild-type cells. In addition, as part of our human outreach project, we have been in touch with leaders in the fields of UAVs, synthetic biology, and earth sciences, and it is clear that biodegradable UAVs could have a significant impact on the industry.

Escherichia↗