Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “mock”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 883 records · Page 49
All sourcesNASA NTRSDOE OSTI
DOE OSTI2012

Shopping For Danger: E-commerce techniques applied to collaboration in cyber security

Collaboration among cyber security analysts is essential to a successful protection strategy on the Internet today, but it is uncommonly practiced or encouraged in operating environments. Barriers to productive collaboration often include data sensitivity, time and effort to communicate, institutional policy, and protection of domain knowledge. We propose an ambient collaboration framework, Vulcan, designed to remove the barriers of time and effort and mitigate the others. Vulcan automated data collection, collaborative filtering, and asynchronous dissemination, eliminating the effort implied by explicit collaboration among peers. We instrumented two analytic applications and performed a mock analysis session to build a dataset and test the output of the system.

99 GENERAL AND MISCELLANEOUS↗
DOE OSTI2017

Building Halo Merger Trees from the Q Continuum Simulation

Cosmological N-body simulations rank among the most computationally intensive efforts today. A key challenge is the analysis of structure, substructure, and the merger history for many billions of compact particle clusters, called halos. Effectively representing the merging history of halos is essential for many galaxy formation models used to generate synthetic sky catalogs, an important application of modern cosmological simulations. Generating realistic mock catalogs requires computing the halo formation history from simulations with large volumes and billions of halos over many time steps, taking hundreds of terabytes of analysis data. We present fast parallel algorithms for producing halo merger trees and tracking halo substructure from a single-level, density-based clustering algorithm. Merger trees are created from analyzing the halo-particle membership function in adjacent snapshots, and substructure is identified by tracking the "cores" of merging halos - sets of particles near the halo center. Core tracking is performed after creating merger trees and uses the relationships found during tree construction to associate substructures with hosts. The algorithms are implemented with MPI and evaluated on a Cray XK7 supercomputer using up to 16,384 processes on data from HACC, a modern cosmological simulation framework. We present results for creating merger trees from 101 analysis snapshots taken from the Q Continuum, a large volume, high mass resolution, cosmological simulation evolving half a trillion particles.

79 ASTRONOMY AND ASTROPHYSICS↗
DOE OSTI2019

Automated Fortran–C++ Bindings for Large-Scale Scientific Applications

Although many active scientific codes use modern Fortran, most contemporary scientific software libraries are implemented in C and C++. Providing their numerical, algorithmic, or data management features to Fortran codes requires writing and maintaining substantial amounts of glue code. This paper introduces a tool that automatically generates native Fortran 2003 interfaces to C and C++ libraries. The tool supports C++ features that have no direct Fortran analog, such as templated functions and exceptions. Finally, a set of simple examples demonstrates the utility and scope of the tool, and timing measurements with a mock numerical library illustrate the minimal performance impact of the generated wrapper code.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2018

Temporal Decompostion of a Distribution System Quasi-Static Time-Series Simulation

This paper documents the first phase of an investigation into reducing runtimes of complex OpenDSS models through parallelization. As the method seems promising, future work will quantify - and further mitigate - errors arising from this process. In this initial report, we demonstrate how, through the use of temporal decomposition, the run times of a complex distribution-system-level quasi-static time series simulation can be reduced roughly proportional to the level of parallelization. Using this method, the monolithic model runtime of 51 hours was reduced to a minimum of about 90 minutes. As expected, this comes at the expense of control- and voltage-errors at the time-slice boundaries. All evaluations were performed using a real distribution circuit model with the addition of 50 PV systems - representing a mock complex PV impact study. We are able to reduce induced transition errors through the addition of controls initialization, though small errors persist. The time savings with parallelization are so significant that we feel additional investigation to reduce control errors is warranted.

14 SOLAR ENERGY↗
DOE OSTI2016

Hardware-in-the-Loop Co-simulation of Distribution Grid for Demand Response

In modern power systems, co-simulation is proposed as an enabler for analyzing the interactions between disparate systems. This paper introduces the co-simulation platform Virtual Grid Integration Laboratory (VirGIL) including Hardware-in-the-Loop testing, and demonstrates its potential to assess demand response strategies. VirGIL is based on a modular architecture using the Functional Mock-up Interface industrial standard to integrate new simulators. VirGIL combines state-of-the-art simulators in power systems, communications, buildings, and control. In this work, VirGIL is extended with a Hardware-in-the-Loop component to control the ventilation system of a real 12-story building in Denmark. VirGIL capabilities are illustrated in three scenarios: load following, primary reserves and load following aggregation. Experimental results show that the system can track one minute changing signals and it can provide primary reserves for up-regulation. Furthermore, the potential of aggregating several ventilation systems is evaluated considering the impact at distribution grid level and the communications protocol effect.

Rotger-Griful, Sergi↗
DOE OSTI2012

Field Evaluation of the Potential for Creep in Thermoplastic Encapsulant Materials: Preprint

There has been recent interest in the use of thermoplastic encapsulant materials in photovoltaic modules to replace chemically crosslinked materials, e.g., ethylene-vinyl acetate. The related motivations include the desire to: reduce lamination time or temperature; use less moisture-permeable materials; use materials with better corrosion characteristics or with improved electrical resistance.However, the use of any thermoplastic material in a high-temperature environment raises safety and performance concerns, as the standardized tests currently do not expose the modules to temperatures in excess of 85 degrees C, though fielded modules may experience temperatures above 100 degrees C. Here we constructed eight pairs of crystalline-silicon modules and eight pairs ofglass/encapsulation/glass thin-film mock modules using different encapsulant materials of which only two were designed to chemically crosslink. One module set was exposed outdoors with insulation on the back side in Arizona in the summer, and an identical set was exposed in environmental chambers. High precision creep measurements (+/- 20 um) and performance measurements indicate that despitemany of these polymeric materials being in the melt state during outdoor deployment, very little creep was seen because of their high viscosity, temperature heterogeneity across the modules, and the formation of chemical crosslinks in many of the encapsulants as they aged. In the case of the crystalline silicon modules, the physical restraint of the backsheet reduced the creep further.

14 SOLAR ENERGY↗
DOE OSTI2014

Trial-Run of a Junction-Box Attachment Test for Use in Photovoltaic Module Qualification: Preprint

Engineering robust adhesion of the junction box (j-box) is a hurdle typically encountered by photovoltaic module manufacturers during product development and manufacturing process control. There are historical incidences of adverse effects (e.g., fires) caused when the j-box/adhesive/module system has failed in the field. The addition of a weight to the j-box during the 'damp-heat,' 'thermal-cycle,' or 'creep' tests within the IEC qualification protocol is proposed to verify the basic robustness of the adhesion system. The details of the proposed test are described, in addition to a trial-run of the test procedure. The described experiments examine four moisture-cured silicones, four foam tapes, and a hot-melt adhesive used in conjunction with glass, KPE, THV, and TPE substrates. For the purpose of validating the experiment, j-boxes were adhered to a substrate, loaded with a prescribed weight, and then subjected to aging. The replicate mock-modules were aged in an environmental chamber (at 85 degrees C/85% relative humidity for 1000 hours; then 100 degrees C/<10% relative humidity for 200 hours) or fielded in Golden (CO), Miami (FL), and Phoenix (AZ) for one year. Attachment strength tests, including pluck and shear test geometries, were also performed on smaller component specimens.

14 SOLAR ENERGY↗
DOE OSTI2020

High-Field Ignition-Capable Stellarator i-ASTER: Initial Structural Evaluation

i-ASTER is a preliminary conceptual design of a high-field pulsed experimental stellarator aimed essentially at achieving and understanding plasma ignition. The averaged magnetic field on the axis of i-ASTER.v1 is B ~ 10 T and the plasma volume is 30 m 3 . A toroidal monolithic support structure, which is located externally to the modular coils, is defined to accurately arrange the coils and withstand the magnetic Lorentz forces from the high magnetic fields. The magnetic field in the coils and the resulting Lorentz forces on the coils were calculated and utilized for the stress calculation in monolithic support of constant thickness. Subsequently, a monolithic support of variable thickness is proposed and studied. The thickness of the structure is variable and adjusted to the magnitude of the mechanical stress in each area of the toroidal structure so as to smooth the stresses while minimizing the quantity of material used. A fabrication method for the monolithic structure has been tested. For that, a scaled-down mock-up of one period of stellarator has been additively manufactured and strengthened with fiber-reinforced resin. Unsurmountable difficulties have not been found for this fabrication method.

Queral, Vicente↗
DOE OSTI2017

Crop‐associated virus infection in a native perennial grass: reduction in plant fitness and dynamic patterns of virus detection

Summary To understand the eco‐evolutionary significance of plant viruses in nature, we must (i) quantify the effects of infection on plant fitness and (ii) recognize that native plants are increasingly exposed to crop‐associated viruses. Studies of perennials are particularly needed: most of our knowledge of plant‐virus interactions is from annuals, yet long‐lived species dominate landscapes. Here we used aster models for life‐history analysis and longitudinal measures of plant virus status to evaluate multi‐year consequences of crop virus infection in a native perennial. We used Barley yellow dwarf virus acquired from wheat to inoculate seedlings of P anicum virgatum L. (switchgrass), a North American prairie grass. We grew inoculated and mock‐inoculated individuals of two ecotypes for 3 years in the field. We measured plant size, infection status and fitness components. Aster modelling provided integrated multi‐year measures of fitness. Crop virus inoculation reduced multi‐year native plant fitness by 30% over 2 years despite generally asymptomatic infection and evidence of resistance. This reduction was greater than predicted from individual fitness components or most size measures. Ecotypes differed in response, with the lowland ecotype experiencing higher apparent recovery from infection. Virus treatment in the upland ecotype delayed flowering phenology and reduced seed filling. Synthesis . Our use of field experimentation, surveys of plant infection status and aster modelling demonstrates a rigorous and broadly applicable approach for quantifying the effects of viruses and other microbes on multi‐year plant fitness. We found that a crop virus had negative multi‐year effects on native plant fitness even after infection was no longer detected. Viruses may have substantial effects on native vegetation with domestication of landscapes and agricultural expansion.

Alexander, Helen M.↗
DOE OSTI2021

Escaping the fate of Sisyphus: assessing resistome hybridization baits for antimicrobial resistance gene capture

Finding, characterizing and monitoring reservoirs for antimicrobial resistance (AMR) is vital to protecting public health. Hybridization capture baits are an accurate, sensitive and cost-effective technique used to enrich and characterize DNA sequences of interest, including antimicrobial resistance genes (ARGs), in complex environmental samples. We demonstrate the continued utility of a set of 19 933 hybridization capture baits designed from the Comprehensive Antibiotic Resistance Database (CARD)v1.1.2 and Pathogenicity Island Database (PAIDB)v2.0, targeting 3565 unique nucleotide sequences that confer resistance. We demonstrate the efficiency of our bait set on a custom-made resistance mock community and complex environmental samples to increase the proportion of on-target reads as much as >200-fold. However, keeping pace with newly discovered ARGs poses a challenge when studying AMR, because novel ARGs are continually being identified and would not be included in bait sets designed prior to discovery. Here we provide imperative information on how our bait set performs against CARDv3.3.1, as well as a generalizable approach for deciding when and how to update hybridization capture bait sets. This research encapsulates the full life cycle of baits for hybridization capture of the resistome from design and validation (both in silico and in vitro) to utilization and forecasting updates and retirement.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2016

Full coverage shaped-hole film cooling in an accelerating boundary layer with high freestream turbulence

Full coverage shaped-hole film cooling and downstream heat transfer measurements have been acquired in the accelerating flows over a large cylindrical leading edge test surface. The shaped holes had an 8 deg lateral expansion angled at 30 deg to the surface with spanwise and streamwise spacings of 3 diameters. Measurements were conducted at four blowing ratios, two Reynolds numbers, and six well documented turbulence condi-tions. Film cooling measurements were acquired over a four to one range in blowing ratio at the lower Reynolds number and at the two lower blowing ratios for the higher Reynolds number. The film cooling measurements were acquired at a coolant to free-stream density ratio of approximately 1.04. The flows were subjected to a low turbulence (LT) condition (Tu = 0.7%), two levels of turbulence for a smaller sized grid (Tu = 3.5%and 7.9%), one turbulence level for a larger grid (8.1%), and two levels of turbulence generated using a mock aerocombustor (AC) (Tu = 9.3% and 13.7%). Turbulence level is shown to have a significant influence in mixing away film cooling coverage progressively as the flow develops in the streamwise direction. Effectiveness levels for the AC turbu-lence condition are reduced to as low as 20% of LT values by the furthest downstream region. The film cooling discharge is located close to the leading edge with very thin and accelerating upstream boundary layers. Film cooling data at the lower Reynolds number show that transitional flows have significantly improved effectiveness levels compared with turbulent flows. Downstream effectiveness levels are very similar to slot film cooling data taken at the same coolant flow rates over the same cylindrical test surface. However, slots perform significantly better in the near discharge region. These data are expected to be very useful in grounding computational predictions of full coverage shaped-hole film cooling with elevated turbulence levels and acceleration. Lastly, infrared (IR) measurements were performed for the two lowest turbulence levels to document the spanwise variation in film cooling effectiveness and heat transfer.

20 FOSSIL-FUELED POWER PLANTS↗
DOE OSTI2016

Stagnation region heat transfer augmentation at very high turbulence levels

Current land-based gas turbines are growing in size producing higher approach flow Reynolds numbers at the leading edge of turbine nozzles. These vanes are subjected to high intensity large scale turbulence. This present paper reports on the research which significantly expands the parameter range for stagnation region heat transfer augmenta-tion due to high intensity turbulence. Heat transfer measurements were acquired over two constant heat flux test surfaces with large diameter leading edges (10.16 cm and 40.64 cm). The test surfaces were placed downstream from a new high intensity (17.4%) mock combustor and tested over an eight to one range in approach flow Reynolds number for each test surface. Stagnation region heat transfer augmentation for the smaller (Re D = 15,625–125,000) and larger (Re D = 62,500–500,000) leading edge regions ranged from 45% to 81% and 80% to 136%, respectively. Furthermore, these data also include heat transfer distributions over the full test surface compared with the earlier data acquired at six additional inlet turbulence conditions. These surfaces exhibit continued but more moderate acceleration downstream from the stagnation regions and these data are expected to be useful in testing bypass transition predictive approaches. This database will be useful to gas turbine heat transfer design engineers. [DOI: 10.1115/1.4032677]

20 FOSSIL-FUELED POWER PLANTS↗
DOE OSTI2019

Steel–Concrete Composite Pressure Vessels for Hydrogen Storage at High Pressures

The need to store large quantities of hydrogen in large diameter steel vessels under high pressures results in shell thicknesses that are too large to produce by most steel mills and not practical to fabricate. Accordingly, a research program was undertaken by Oak Ridge National Laboratory to develop a new concept of combining steel with concrete to construct such vessels economically and practically. The concept is to fabricate vessels where the steel shell thickness is approximately one half that required to resist the hoop forces due to internal pressure. As such, the steel shell is designed to carry the full amount of the longitudinal forces in the vessel but only one half of the hoop loads due to internal pressure. The other half of the hoop loads is carried by a prestressed and reinforced concrete shell. In large diameter vessels, the cost of the shell can further be reduced by using layered steel shell construction rather than solid-wall construction. Such shell construction has also the added advantage of easily venting the hydrogen that permeates through the steel shell directly to the atmosphere through vent holes. This mechanism prevents the hydrogen from damaging the steel shell. The theoretical formulation of the steel concrete shell design is presented in this paper. Finally, in addition, details of a full-scale mock up vessel designed, fabricated, and tested to prove the proposed methodology are given.

42 ENGINEERING↗
DOE OSTI2016

Experimental Evaluation of Dual-Opposed Jet Mixer Pump Performance for Slurry Mixing

Million-gallon double-shell tanks at Hanford are used to store transuranic, high-level, and low-level radioactive wastes. These wastes consist of a large volume of salt-laden solution covering a smaller volume of settled sludge primarily containing metal hydroxides. These wastes will be retrieved and processed into immobile waste forms suitable for permanent disposal. Retrieval is an important step in implementing these disposal scenarios. The retrieval concept evaluated is to use submerged dual-nozzle jet mixer pumps with horizontally oriented nozzles located near the tank floor that produce horizontal jets of fluid to mobilize the settled solids. The mixer pumps are oscillated through 180 about a vertical axis so the high velocity fluid jets sweep across the floor of the tank. After the solids are mobilized, the pumps will continue to operate at a reduced flow rate producing lower velocity jets sufficient to maintain the particles in a uniform suspension (concentration uniformity). Several types of waste and tank configurations exist at Hanford. The jet mixer pump systems and operating conditions required to mobilize sludge and maintain slurry uniformity will be a function of the waste type and tank configuration. The focus of this work was to conduct a 1/12-scale experiment to develop an analytical model to relate slurry uniformity to tank and mixer pump configurations, operating conditions, and sludge properties. This experimental study evaluated concentration uniformity in a 1/12-scale experiment varying the Reynolds number (Re), Froude number (Fr), and gravitational settling parameter (Gs) space. Simulant physical properties were chosen to obtain the required Re and Gs where Re and Gs were varied by adjusting the kinematic viscosity and mean particle diameter, respectively. Test conditions were achieved by scaling the jet nozzle exit velocity in a 75-in. diameter tank using a mock-up of a centrally located dual-opposed jet mixer pump located just above the tank floor. Concentration measurements at sampling locations throughout the tank were used to assess the degree of uniformity achieved during each test. Concentration data was obtained using a real time in-situ ultrasonic attenuation probe and post-test analysis of discrete batch samples. The undissolved solids concentration at these locations was analyzed to determine whether the tank contents were uniform (≤ ±10% variation about mean) or nonuniform (> ±10% variation about mean) in concentration. Concentration inhomogeneity was modeled as a function of dimensionless parameters. The parameters that best describe the maximum solids volume fraction that can be suspended were found to be 1) the Fr based on nozzle average discharge velocity and tank contents level and 2) the dimensionless particle size based on nozzle diameter. The dependence on the jet Re does not appear to be statistically significant.

correlation↗
DOE OSTI2024

THERMAL MODELING OF HANFORD CESIUM AND STRONTIUM CANISTERS DURING SIMULATED LOADING

A computational fluid dynamics (CFD) model was built to simulate planned testing of heater assemblies within a canister and overpack for the Hanford Lead Canister (HLC) project. The HLC is a canister storage system that will contain heaters to simulate the decay heat of nuclear material and provide the canister storage system with environmental conditions equivalent to the operating conditions on a dry storage pad. The HLC will be equipped with long-term data collection and monitoring systems to provide an early warning of corrosion, pitting, cracking, or other signs of canister degradation that might threaten the integrity of the containment boundary over the potentially long term of dry storage. An important part of the HLC development is to make pretest numerical predictions for the behavior of the heated canister during the simulated radiolytic decay heat testing, which simulates the dry storage system during loading operations. The simulated radiolytic decay heat test is planned for mid-2024 in a configuration that includes the heater assembly, overpack, and canister, but with the lids removed to allow loading cesium and strontium capsules into the canister. One of the goals of the test is to evaluate the thermal behavior of the canister and overpack assembly in the ambient air of the test facility, which will provide data critical to validating the thermal models and understanding how the HLC will perform as a system once deployed. To best approximate real-world conditions, the CFD model includes the full air volume of the mock-up truck bay the heated canister test will be performed in, enabling detailed investigation of how the heated canister affects airflow around it. Rigorous pre-deployment testing of the complete HLC cask and canister system is intended to be completed before the HLC is deployed in the 2028 timeframe. This study presents the pre-test temperature predictions of the simulated radiolytic decay heat test. A description of the heater assembly, canister, and overpack system is presented. The model was developed with the commercial CFD software STAR-CCM+. An uncertainty analysis was run with the CFD model to determine the uncertainty in the temperature predictions and provide a range over which the predicted temperatures are expected to vary. The uncertainty analysis was preformed by coupling STAR-CCM+ with the software Dakota, which provides advanced parametric analyses, including quantification of margins and uncertainty with computational models. This work is expected to provide insight into SNF canister behavior.

Carpenter-Graffy, Dina E.↗
DOE OSTI2025

Improved field assessments of chemicals and explosives using high-resolution gamma-ray spectroscopy with a tagged neutron interrogation system

A field-portable tagged neutron interrogation system is being developed for detection of explosives and chemical warfare agents by prompt γ-ray neutron activation analysis. The system combines an associated particle imaging deuterium-tritium neutron generator with a high-purity germanium γ-ray detector. Fine spatial resolution neutron and α detectors enable precise mapping of characteristic γ-ray emission distributions onto high-clarity neutron radiographic images. A narrow coincidence gate associated with each tagged neutron ensures a large signal-to-background ratio, thus significantly improving sensitivity to the chemical compositions of the items being assessed. Recent experimental results recorded from test objects involving mock explosives and other chemicals are presented.

Bucher, Brian [Idaho National Laboratory (INL)]↗
DOE OSTI2012

VMAT QA: Measurement-guided 4D dose reconstruction on a patient

Purpose: To develop and validate a volume-modulated arc therapy (VMAT) quality assurance (QA) tool that takes as input a time-resolved, low-density ({approx}10 mm) cylindrical surface dose map from a commercial helical diode array, and outputs a high density, volumetric, time-resolved dose matrix on an arbitrary patient dataset. This first validation study is limited to a homogeneous 'patient.'Methods: A VMAT treatment is delivered to a diode array phantom (ARCCHECK, Sun Nuclear Corp., Melbourne, FL). 3DVH software (Sun Nuclear) derives the high-density volumetric dose using measurement-guided dose reconstruction (MGDR). MGDR cylindrical phantom results are then used to perturb the three-dimensional (3D) treatment planning dose on the patient dataset, producing a semiempirical volumetric dose grid. Four-dimensional (4D) dose reconstruction on the patient is also possible by morphing individual sub-beam doses instead of the composite. For conventional (3D) dose comparison two methods were developed, using the four plans (Multi-Target, C-shape, Mock Prostate, and Head and Neck), including their structures and objectives, from the AAPM TG-119 report. First, 3DVH and treatment planning system (TPS) cumulative point doses were compared to ion chamber in a cube water-equivalent phantom ('patient'). The shape of the phantom is different from the ARCCHECK and furthermore the targets were placed asymmetrically. Second, coronal and sagittal absolute film dose distributions in the cube were compared with 3DVH and TPS. For time-resolved (4D) comparisons, three tests were performed. First, volumetric dose differences were calculated between the 3D MGDR and cumulative time-resolved patient (4D MGDR) dose at the end of delivery, where they ideally should be identical. Second, time-resolved (10 Hz sampling rate) ion chamber doses were compared to cumulative point dose vs time curves from 4D MGDR. Finally, accelerator output was varied to assess the linearity of the 4D MGDR with global fluence change. Results: Across four TG-119 plans, the average PTV point dose difference in the cube between 3DVH and ion chamber is 0.1 {+-} 1.0%. Average film vs TPS {gamma}-analysis passing rates are 83.0%, 91.1%, and 98.4% for 1%/2 mm, 2%/2 mm, and 3%/3 mm threshold combinations, respectively, while average film vs 3DVH {gamma}-analysis passing rates are 88.6%, 96.1%, and 99.5% for the same respective criteria. 4D MGDR was also sufficiently accurate. First, for 99.5% voxels in each case, the doses from 3D and 4D MGDR at the end of delivery agree within 0.5%local dose-error/1 mm distance. Moreover, all failing voxels are confined to the edge of the cylindrical reconstruction volume. Second, dose vs time curves track between the ion chamber and 4D MGDR within 1%. Finally, 4D MGDR dose changes linearly with the accelerator output: the difference between cumulative ion chamber and MGDR dose changed by no more than 1% (randomly) with the output variation range of 10%. Conclusions: Even for a well-commissioned TPS, comparison metrics show better agreement on average to MGDR than to TPS on the arbitrary-shaped measurable 'patient.' The method requires no more accelerator time than standard QA, while producing more clinically relevant information. Validation in a heterogeneous thoracic phantom is under way, as is the ultimate application of 4D MGDR to virtual motion studies.

60 APPLIED LIFE SCIENCES↗