Association Genetics of Chemical Wood Properties in Black Poplar (Populus nigra)
Abstract not provided
09 BIOMASS FUELS↗
SEARCH · Engineering Papers
Results for “Neal”
Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Discovering candidate genes that regulate resin canal number in Pinus taeda stems by integrating genetic analysis across environments, ages, and populations
Genetically improving constitutive resin canal development in Pinus stems may enhance the capacity to synthesize terpenes for bark beetle resistance, chemical feedstocks, and biofuels. To discover genes that potentially regulate axial resin canal number (RCN), single nucleotide polymorphisms (SNPs) in 4027 genes were tested for association with RCN in two growth rings and three environments in a complex pedigree of 520 Pinus taeda individuals (CCLONES). The map locations of associated genes were compared with RCN quantitative trait loci (QTLs) in a (P.taedaxPinuselliottii)xP.elliottii pseudo-backcross of 345 full-sibs (BC1). Resin canal number was heritable (h(2)0.12-0.21) and positively genetically correlated with xylem growth (r(g)0.32-0.72) and oleoresin flow (r(g)0.15-0.51). Sixteen well-supported candidate regulators of RCN were discovered in CCLONES, including genes associated across sites and ages, unidirectionally associated with oleoresin flow and xylem growth, and mapped to RCN QTLs in BC1. Breeding is predicted to increase RCN 11% in one generation and could be accelerated with genomic selection at accuracies of 0.45-0.52 across environments. There is significant genetic variation for RCN in loblolly pine, which can be exploited in breeding for elevated terpene content.
Westbrook, JW↗
High-throughput deep sequencing shows that microRNAs play important roles in switchgrass responses to drought and salinity stress
Explore the source record for details and available documents.
Fuliang, Xie↗
Identification and Overexpression of Gibberellin 2-Oxidase (GA2ox) in Switchgrass (Panicum virgatum L.) for Improved Plant Architecture and Reduced Biomass Recalcitrance
Explore the source record for details and available documents.
09 BIOMASS FUELS↗
Transgenic soybean overexpressing GmSAMT1 exhibits resistance to multiple-HG types of soybean cyst nematode Heterodera glycines
Soybean ( Glycine max (L.) Merr.) salicylic acid methyl transferase (GmSAMT1) catalyses the conversion of salicylic acid to methyl salicylate. Prior results showed that when GmSAMT1 was overexpressed in transgenic soybean hairy roots, resistance is conferred against soybean cyst nematode (SCN), Heterodera glycines Ichinohe. In this study, we produced transgenic soybean overexpressing GmSAMT1 and characterized their response to various SCN races. Transgenic plants conferred a significant reduction in the development of SCN HG type 1.2.5.7 (race 2), HG type 0 (race 3) and HG type 2.5.7 (race 5). Among transgenic lines, GmSAMT1 expression in roots was positively associated with SCN resistance. In some transgenic lines, there was a significant decrease in salicylic acid titer relative to control plants. No significant seed yield differences were observed between transgenics and control soybean plants grown in one greenhouse with 22 °C day/night temperature, whereas transgenic soybean had higher yield than controls grown a warmer greenhouse (27 °C day/23 °C night) temperature. In a 1-year field experiment in Knoxville, TN, there was no significant difference in seed yield between the transgenic and nontransgenic soybean under conditions with negligible SCN infection. We hypothesize that GmSAMT1 expression affects salicylic acid biosynthesis, which, in turn, attenuates SCN development, without negative consequences to soybean yield or other morphological traits. Furthermore, we conclude that GmSAMT1 overexpression confers broad resistance to multiple SCN races, which would be potentially applicable to commercial production.
59 BASIC BIOLOGICAL SCIENCES↗
Transgenic switchgrass ( Panicum virgatum L.) targeted for reduced recalcitrance to bioconversion: A two-year comparative analysis of field-grown lines modified for target gene or genetic element expression
Five different types of transgenic ( GAUT4 , miRNA, MYB4, COMT and FPGS ) Panicum virgatum L. (switchgrass) were grown in a field in Knoxville, Tenn., USA over two consecutive years between 2011 and 2015 in separate experiments. Clonal replicates were established (year-one) and produced much greater biomass during the second year. After each growing season the above ground biomass was analyzed for cell wall sugars and for recalcitrance to enzymatic digestibility, and biofuel using a separate hydrolysis and fermentation (SHF) screen. Here, each transgenic event and control had more glucan, xylan and less ethanol (g/g basis) from the second year of growth relative to the first year plants. There was no correlation between plant carbohydrate content and biofuel production. In each of cell wall-targeted transgenics, GAUT4 , MYB4, COMT and FPGS , the second year of growth resulted in increased carbohydrate abundance (up to 12%) and reduced recalcitrance through higher ethanol yields (up to 21%) over the non-transgenic control plants.
59 BASIC BIOLOGICAL SCIENCES↗
Transgenic miR156 switchgrass in the field: growth, recalcitrance and rust susceptibility
Not Available
09 BIOMASS FUELS↗
Imaging of multiple fluorescent proteins in canopies enables synthetic biology in plants
Reverse genetics approaches have revolutionized plant biology and agriculture. Phenomics has the prospect of bridging plant phenotypes with genes, including transgenes, to transform agricultural fields. Genetically encoded fluorescent proteins (FPs) have revolutionized plant biology paradigms in gene expression, protein trafficking and plant physiology. While the first instance of plant canopy imaging of green fluorescent protein (GFP) was performed over 25 years ago, modern phenomics has largely ignored fluorescence as a transgene expression device despite the burgeoning FP colour palette available to plant biologists. Here, we show a new platform for stand-off imaging of plant canopies expressing a wide variety of FP genes. The platform-the fluorescence-inducing laser projector (FILP)-uses an ultra-low-noise camera to image a scene illuminated by compact diode lasers of various colours, coupled with emission filters to resolve individual FPs, to phenotype transgenic plants expressing FP genes. Each of the 20 FPs screened in plants were imaged at >3 m using FILP in a laboratory-based laser range. We also show that pairs of co-expressed fluorescence proteins can be imaged in canopies. The FILP system enabled a rapid synthetic promoter screen: starting from 2000 synthetic promoters transfected into protoplasts to FILP-imaged agroinfiltrated Nicotiana benthamiana plants in a matter of weeks, which was useful to characterize a water stress-inducible synthetic promoter. FILP canopy imaging was also accomplished for stably transformed GFP potato and in a split-GFP assay, which illustrates the flexibility of the instrument for analysing fluorescence signals in plant canopies.
abiotic stress↗
Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements
Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.
09 BIOMASS FUELS↗
Mini‐synplastomes for plastid genetic engineering
Summary In the age of synthetic biology, plastid engineering requires a nimble platform to introduce novel synthetic circuits in plants. While effective for integrating relatively small constructs into the plastome, plastid engineering via homologous recombination of transgenes is over 30 years old. Here we show the design–build–test of a novel synthetic genome structure that does not disturb the native plastome: the ‘mini‐synplastome’. The mini‐synplastome was inspired by dinoflagellate plastome organization, which is comprised of numerous minicircles residing in the plastid instead of a single organellar genome molecule. The first mini‐synplastome in plants was developed in vitro to meet the following criteria: (i) episomal replication in plastids; (ii) facile cloning; (iii) predictable transgene expression in plastids; (iv) non‐integration of vector sequences into the endogenous plastome; and (v) autonomous persistence in the plant over generations in the absence of exogenous selection pressure. Mini‐synplastomes are anticipated to revolutionize chloroplast biotechnology, enable facile marker‐free plastid engineering, and provide an unparalleled platform for one‐step metabolic engineering in plants.
Occhialini, Alessandro↗
Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar
Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.
59 BASIC BIOLOGICAL SCIENCES↗
Salinity-Induced Photorespiration in Populus Vascular Tissues Facilitate Nitrogen Reallocation
Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. Here, we used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell-specific changes in proteins and metabolites were determined. Salinity induced a vascular-specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3-phosphoglycerate and NH 4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH 4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt-induced photorespiration in vascular cells mediates N-reallocation in Populus, an essential process for the adaptation of trees to adverse conditions.
59 BASIC BIOLOGICAL SCIENCES↗
Model Form Error Correction for a Black-Box Thermal Battery Heat Transfer Simulation
Thermal batteries are crucial for supplying power to high-consequence engineering applications such as rockets. Computational simulations have been developed to predict thermal battery behavior, but these simulations often suffer from modeling errors, including model form uncertainty. Addressing this uncertainty can be achieved by quantifying either the model discrepancy in the output or the model form error (MFE) in the governing equation. MFE is particularly valuable as it can be better extrapolated beyond observed outputs, which is essential for predictions involving changes in external system loading, system configuration and geometry, or output quantities. This paper employs a state estimation approach to estimate MFE using experimental data and then utilizes machine learning (ML) to model its relationship with state variables. A nonintrusive technique is used to estimate MFE in a black-box thermal battery heat transfer simulation. The trained machine learning model for MFE is then applied to correct simulation predictions under extrapolated initial conditions and battery configurations. In conclusion, the methodology's performance is evaluated using additional experimental data, demonstrating its effectiveness in improving prediction accuracy.
Batteries↗
Development of atomic layer deposition-activated microchannel plates for single particle detection at cryogenic temperatures
Atomic layer deposition (ALD) technology is used to nanoengineer functional films inside the pores of microchannel plate (MCP) electron multipliers, enabling a novel MCP manufacturing technology that substantially improves performance and opens novel applications. The authors have developed custom tools and recipes for the growth of conformal films, with optimized conductance and secondary electron emission inside very long channels (∼6–20 μm diameter and >600 μm length, with tens of millions of channels per single MCP) by ALD. The unique ability to tune the characteristics of these ALD films enables their optimization to applications where time-resolved single particle imaging can be performed in extreme conditions, such as high counting rates at cryogenic temperatures. Adhesion of the conductive and emissive nanofilms to the 20 μm pore MCP glass substrates and their mechanical stability over a very wide range of temperatures (10–700 K) were confirmed experimentally. Resistance of ALD MCPs was reproducible during multiple cool-down cycles with no film degradation observed. Optimizing resistance of novel MCPs for operation at cryogenic temperature should enable high count rate event detection at temperatures below 20 K.
75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
Improving vacuum performance in the warm linac of the Spallation Neutron Source
The Spallation Neutron Source is an accelerator-based neutron source built and operated by the U.S. Department of Energy in Oak Ridge, Tennessee. With over 10 years of operation at 1 MW of power and above, shortcomings have been identified in the original vacuum pumping scheme for the drift tube and the coupled cavity linear accelerator sections. In this article, the vacuum performance for these systems is reviewed and the major areas of concern are discussed. The changes to the vacuum system are examined and the final design is described. Finally, the performance impact of these changes after a year of operation with the new vacuum system is presented.
47 OTHER INSTRUMENTATION↗
Practical guide to understanding goodness-of-fit metrics used in chemical state modeling of x-ray photoelectron spectroscopy data by synthetic line shapes using nylon as an example
Chemical state analysis of a sample surface through fitting bell-shaped curves to x-ray photoelectron spectroscopic polymer data is reviewed using nylon to introduce and discuss aspects of data analysis. Different strategies for modeling chemistry in nylon spectra are presented and in so doing, a case is made to include in published science the design logic and implementation in terms of line shapes and optimization parameter constraints between components in a peak model. Imperfections in line shape relative to the true shape for photoemission lines, when compensated for using constraints to optimization parameters, are shown to provide chemical state information about a sample that justify, for peak models constructed with these limitations, metrics for goodness-of-fit different from those expected for pulse-counted data.
Materials Science↗
Melt-grown semi-insulating Mn:β-Ga 2 O 3 single crystals exhibiting unique visible absorptions and luminescence
In this study, several acceptor dopants have been explored in β-Ga 2 O 3 to produce semi-insulating substrates and epitaxial films. Fe and Mg make up the majority of research thus far; however, other transition metals provide potential alternatives for optimized performance. β-Ga 2 O 3 bulk single crystals were grown by the Czochralski and vertical gradient freeze methods with a nominal dopant concentration of 0.25 at. % Mn. Ultraviolet-visible-near infrared spectroscopy and photoluminescence revealed polarization- and orientation-dependent optical absorptions (pleochroism) coupled with an orange luminescence. All samples were electrically insulating, on the order of 10 9 –10 11 ohm cm at room temperature, indicative of acceptor doping. Actual dopant concentrations of the intentionally doped transition metal and background impurities were determined via glow discharge mass spectrometry, indicating the macroscale segregation behavior. High-temperature resistivity measurements indicated an experimental acceptor level of 1.7 ± 0.2 eV. Hydrogenation of samples resulted in an increase in the orange luminescence and O–H stretching modes observable in the infrared spectrum. Density functional theory calculations were performed to determine the likely site-occupancy and acceptor level of Mn in the bandgap.
36 MATERIALS SCIENCE↗