Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “RNA sequencing”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 811 records · Page 45
All sourcesNASA NTRSDOE OSTI
DOE OSTI2016

New CRISPR–Cas systems from uncultivated microbes

We present that CRISPR-Cas systems provide microbes with adaptive immunity by employing short DNA sequences, termed spacers, that guide Cas proteins to cleave foreign DNA. Class 2 CRISPR-Cas systems are streamlined versions, in which a single RNA-bound Cas protein recognizes and cleaves target sequences. The programmable nature of these minimal systems has enabled researchers to repurpose them into a versatile technology that is broadly revolutionizing biological and clinical research. However, current CRISPR-Cas technologies are based solely on systems from isolated bacteria, leaving the vast majority of enzymes from organisms that have not been cultured untapped. Metagenomics, the sequencing of DNA extracted directly from natural microbial communities, provides access to the genetic material of a huge array of uncultivated organisms. Here, using genome-resolved metagenomics, we identify a number of CRISPR-Cas systems, including the first reported Cas9 in the archaeal domain of life, to our knowledge. This divergent Cas9 protein was found in little-studied nanoarchaea as part of an active CRISPR-Cas system. In bacteria, we discovered two previously unknown systems, CRISPR-CasX and CRISPR-CasY, which are among the most compact systems yet discovered. Notably, all required functional components were identified by metagenomics, enabling validation of robust in vivo RNA-guided DNA interference activity in Escherichia coli. Lastly, interrogation of environmental microbial communities combined with in vivo experiments allows us to access an unprecedented diversity of genomes, the content of which will expand the repertoire of microbe-based biotechnologies.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2014

Proteogenomic strategies for identification of aberrant cancer peptides using large-scale Next Generation Sequencing data

Cancer is driven by the acquisition of somatic DNA lesions. Distinguishing the early driver mutations from subsequent passenger mutations is key to molecular sub-typing of cancers, and the discovery of novel biomarkers. The availability of genomics technologies (mainly wholegenome and exome sequencing, and transcript sampling via RNA-seq, collectively referred to as NGS) have fueled recent studies on somatic mutation discovery. However, the vision is challenged by the complexity, redundancy, and errors in genomic data, and the difficulty of investigating the proteome using only genomic approaches. Recently, combination of proteomic and genomic technologies are increasingly employed. However, the complexity and redundancy of NGS data remains a challenge for proteogenomics, and various trade-offs must be made to allow for the searches to take place. This paperprovides a discussion of two such trade-offs, relating to large database search, and FDR calculations, and their implication to cancer proteogenomics. Moreover, it extends and develops the idea of a unified genomic variant database that can be searched by any mass spectrometry sample. A total of 879 BAM files downloaded from TCGA repository were used to create a 4.34 GB unified FASTA database which contained 2,787,062 novel splice junctions, 38,464 deletions, 1105 insertions, and 182,302 substitutions. Proteomic data from a single ovarian carcinoma sample (439,858 spectra) was searched against the database. By applying the most conservative FDR measure, we have identified 524 novel peptides and 65,578 known peptides at 1% FDR threshold. The novel peptides include interesting examples of doubly mutated peptides, frame-shifts, and non-sample-recruited mutations, which emphasize the strength of our approach.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

The CRISPR effector Cam1 mediates membrane depolarization for phage defence

Prokaryotic type III CRISPR–Cas systems provide immunity against viruses and plasmids using CRISPR-associated Rossman fold (CARF) protein effectors. Recognition of transcripts of these invaders with sequences that are complementary to CRISPR RNA guides leads to the production of cyclic oligoadenylate second messengers, which bind CARF domains and trigger the activity of an effector domain. Whereas most effectors degrade host and invader nucleic acids, some are predicted to contain transmembrane helices without an enzymatic function. Whether and how these CARF–transmembrane helix fusion proteins facilitate the type III CRISPR–Cas immune response remains unknown. Here we investigate the role of cyclic oligoadenylate-activated membrane protein 1 (Cam1) during type III CRISPR immunity. Structural and biochemical analyses reveal that the CARF domains of a Cam1 dimer bind cyclic tetra-adenylate second messengers. In vivo, Cam1 localizes to the membrane, is predicted to form a tetrameric transmembrane pore, and provides defence against viral infection through the induction of membrane depolarization and growth arrest. These results reveal that CRISPR immunity does not always operate through the degradation of nucleic acids, but is instead mediated via a wider range of cellular responses.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

tSFM 1.0: tRNA Structure–Function Mapper

Structure-conditioned information statistics have proven useful to predict and visualize tRNA Class-Informative Features (CIFs) and their evolutionary divergences. Although permutation P-values can quantify the significance of CIF divergences between two taxa, their naive Monte Carlo approximation is slow and inaccurate. The Peaks-over-Threshold approach of Knijnenburg et al. (2009) promises improvements to both speed and accuracy of permutation P-values, but has no publicly available API. Here, we present tRNA Structure–Function Mapper (tSFM) v1.0, an open-source, multi-threaded application that efficiently computes, visualizes and assesses significance of single- and paired-site CIFs and their evolutionary divergences for any RNA, protein, gene or genomic element sequence family. Multiple estimators of permutation P-values for CIF evolutionary divergences are provided along with confidence intervals. tSFM is implemented in Python 3 with compiled C extensions and is freely available through GitHub (https://github.com/tlawrence3/tSFM) and PyPI.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2014

Solution Hybrid Selection Capture for the Recovery of Functional Full-Length Eukaryotic cDNAs From Complex Environmental Samples

Eukaryotic microbial communities play key functional roles in soil biology and potentially represent a rich source of natural products including biocatalysts. Culture-independent molecular methods are powerful tools to isolate functional genes from uncultured microorganisms. However, none of the methods used in environmental genomics allow for a rapid isolation of numerous functional genes from eukaryotic microbial communities. We developed an original adaptation of the solution hybrid selection (SHS) for an efficient recovery of functional complementary DNAs (cDNAs) synthesized from soil-extracted polyadenylated mRNAs. This protocol was tested on the Glycoside Hydrolase 11 gene family encoding endo-xylanases for which we designed 35 explorative 31-mers capture probes. SHS was implemented on four soil eukaryotic cDNA pools. After two successive rounds of capture, >90% of the resulting cDNAs were GH11 sequences, of which 70% (38 among 53 sequenced genes) were full length. Between 1.5 and 25% of the cloned captured sequences were expressed in Saccharomyces cerevisiae . Sequencing of polymerase chain reaction-amplified GH11 gene fragments from the captured sequences highlighted hundreds of phylogenetically diverse sequences that were not yet described, in public databases. This protocol offers the possibility of performing exhaustive exploration of eukaryotic gene families within microbial communities thriving in any type of environment.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2015

Quest for Orthologs Entails Quest for Tree of Life: In Search of the Gene Stream

Quest for Orthologs (QfO) is a community effort with the goal to improve and benchmark orthology predictions. As quality assessment assumes prior knowledge on species phylogenies, we investigated the congruency between existing species trees by comparing the relationships of 147 QfO reference organisms from six Tree of Life (ToL)/species tree projects: The National Center for Biotechnology Information (NCBI) taxonomy, Opentree of Life, the sequenced species/species ToL, the 16S ribosomal RNA (rRNA) database, and trees published by Ciccarelli et al. (Ciccarelli FD, et al. 2006. Toward automatic reconstruction of a highly resolved tree of life. Science 311:1283–1287) and by Huerta-Cepas et al. (Huerta-Cepas J, Marcet-Houben M, Gabaldon T. 2014. A nested phylogenetic reconstruction approach provides scalable resolution in the eukaryotic Tree Of Life. PeerJ PrePrints 2:223) Our study reveals that each species tree suggests a different phylogeny: 87 of the 146 (60%) possible splits of a dichotomous and rooted tree are congruent, while all other splits are incongruent in at least one of the species trees. Topological differences are observed not only at deep speciation events, but also within younger clades, such as Hominidae, Rodentia, Laurasiatheria, or rosids. The evolutionary relationships of 27 archaea and bacteria are highly inconsistent. By assessing 458,108 gene trees from 65 genomes, we show that consistent species topologies are more often supported by gene phylogenies than contradicting ones. The largest concordant species tree includes 77 of the QfO reference organisms at the most. Results are summarized in the form of a consensus ToL (http://swisstree.vital-it.ch/species_tree) that can serve different benchmarking purposes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2016

Brucella melitensis Methionyl-tRNA-Synthetase (MetRS), a Potential Drug Target for Brucellosis

We investigated Brucella melitensis methionyl-tRNA-synthetase (BmMetRS) with molecular, structural and phenotypic methods to learn if BmMetRS is a promising target for brucellosis drug development. Recombinant BmMetRS was expressed, purified from wild type Brucella melitensis biovar Abortus 2308 strain ATCC/CRP #DD-156 and screened by a thermal melt assay against a focused library of one hundred previously classified methionyl-tRNA-synthetase inhibitors of the blood stage form of Trypanosoma brucei. Three compounds showed appreciable shift of denaturation temperature and were selected for further studies on inhibition of the recombinant enzyme activity and cell viability against wild type B. melitensis strain 16M. BmMetRS protein complexed with these three inhibitors resolved into three-dimensional crystal structures and was analyzed. All three selected methionyl-tRNA-synthetase compounds inhibit recombinant BmMetRS enzymatic functions in an aminoacylation assay at varying concentrations. Furthermore, growth inhibition of B. melitensis strain 16M by the compounds was shown. Inhibitor-BmMetRS crystal structure models were used to illustrate the molecular basis of the enzyme inhibition. Our current data suggests that BmMetRS is a promising target for brucellosis drug development. However, further studies are needed to optimize lead compound potency, efficacy and safety as well as determine the pharmacokinetics, optimal dosage, and duration for effective treatment.

60 APPLIED LIFE SCIENCES↗
NASA NTRS2004

gyrB as a phylogenetic discriminator for members of the Bacillus anthracis-cereus-thuringiensis group

Bacillus anthracis, the causative agent of the human disease anthrax, Bacillus cereus, a food-borne pathogen capable of causing human illness, and Bacillus thuringiensis, a well-characterized insecticidal toxin producer, all cluster together within a very tight clade (B. cereus group) phylogenetically and are indistinguishable from one another via 16S rDNA sequence analysis. As new pathogens are continually emerging, it is imperative to devise a system capable of rapidly and accurately differentiating closely related, yet phenotypically distinct species. Although the gyrB gene has proven useful in discriminating closely related species, its sequence analysis has not yet been validated by DNA:DNA hybridization, the taxonomically accepted "gold standard". We phylogenetically characterized the gyrB sequences of various species and serotypes encompassed in the "B. cereus group," including lab strains and environmental isolates. Results were compared to those obtained from analyses of phenotypic characteristics, 16S rDNA sequence, DNA:DNA hybridization, and virulence factors. The gyrB gene proved more highly differential than 16S, while, at the same time, as analytical as costly and laborious DNA:DNA hybridization techniques in differentiating species within the B. cereus group.

Phylogeny↗
NASA NTRS1986

Characteristic archaebacterial 16S rRNA oligonucleotides

A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

NASA Discipline Exobiology↗
NASA NTRS1995

Modeling of a possible conformational change associated with the catalytic mechanism in the hammerhead ribozyme

Here we describe a possible model of the cleavage mechanism in the hammerhead ribozyme. In this model, the 2' hydroxyl of C17 is moved into an appropriate orientation for an in-line attack on the G1.1 phosphate through a change in its sugar pucker from C3' endo to C2' endo. This conformational change in the active site is caused by a change in the uridine turn placing the N2 and N3 atoms of G5 of the conserved core in hydrogen bonding geometry with the N3 and N2 atoms on the conserved G16.2 residue. The observed conformational change in the uridine turn suggests an explanation for the conservation of G5. In the crystal structure of H.M. Pley et al., Nature 372, 68-74 (1994), G5 is situated 5.3A away from G16.2. However, the uridine turn is sufficiently flexible to allow this conformational change with relatively modest changes in the backbone torsion angles (average change of 14.2 degrees). Two magnesium ions were modeled into the active site with positions analogous to those described in the functionally similar Klenow fragment 3'-5' exonuclease (L.S. Beese and T.A. Steitz, EMBO J. 10, 25-33 (1991)), the Group I intron (T.A. Steitz and J.A. Steitz, P.N.A.S. U.S.A. 90, 6498-6502 (1993); R.F. Setlik et al., J. Biomol. Str. Dyn. 10, 945-972 (1993)) and other phosphotransferases. Comparison of this model with one in which the uridine turn conformation was not changed showed that although the changes in the C17 sugar pucker could be modeled, insufficient space existed for the magnesium ions in the active site.

Non-NASA Center↗
NASA NTRS1996

Gravitational loading of a simulated launch alters mRNA expression in osteoblasts

Serum-deprived mouse osteoblastic cells (MC3T3-E1a) were centrifuged under a regime designed to simulate a space shuttle launch (maximum of 3g). Messenger RNA levels for eight genes involved in bone growth and maintenance were determined using RT-PCR. Following 30 min of centrifugation, mRNA level for early response gene c-fos was significantly increased 89% (P < 0.05). The c-fos induction was transient and returned to control levels after 3 h. The mRNA level for the mineralization marker gene osteocalcin was significantly decreased to 44% of control level (P < 0.005) 3 h after centrifugation. No changes in mRNA levels were detected for c-myc, TGFbeta1, TGFbeta2, cyclophilin A, or actin. No basal mRNA level for TGFbeta3 was detected. In addition, no change in the steady-state synthesis of prostaglandin E2 was detected, possibly due to lack of lipid substrates in serum-deprived cells, suggesting that the increase in c-fos mRNA in response to gravitational loading is a result of mechanical stimulation. These results indicate that a small magnitude mechanical loading, such as that experienced during a shuttle launch, can alter mRNA levels in quiescent osteoblastic cells.

Non-NASA Center↗
NASA NTRS2004

Microbial Characterization During the Early Habitation of the International Space Station

An evaluation of the microbiota from air, water, and surface samples provided a baseline of microbial characterization onboard the International Space Station (ISS) to gain insight into bacterial and fungal contamination during the initial stages of construction and habitation. Using 16S genetic sequencing and rep-PCR, 63 bacterial strains were isolated for identification and fingerprinted for microbial tracking. Of the bacterial strains that were isolated and fingerprinted, 19 displayed similarity to each other. The use of these molecular tools allowed for the identification of bacteria not previously identified using automated biochemical analysis and provided a clear indication of the source of several ISS contaminants. Strains of Bradyrhizobium and Sphingomonas unable to be identified using sequencing were identified by comparison of rep-PCR DNA fingerprints. Distinct DNA fingerprints for several strains of Methylobacterium provided a clear indication of the source of an ISS water supply contaminant. Fungal and bacterial data acquired during monitoring do not suggest there is a current microbial hazard to the spacecraft, nor does any trend indicate a potential health risk. Previous spacecraft environmental analysis indicated that microbial contamination will increase with time and will require continued surveillance. Copyright 2004 Springer-Verlag.

Fungi/genetics↗
DOE OSTI2016

Morphological and molecular characterization of fungal pathogen, Magnaphorthe oryzae

Rice is arguably the most crucial food crops supplying quarter of calories intake. Fungal pathogen, Magnaphorthe oryzae promotes blast disease unconditionally to gramineous host including rice species. This disease spurred an outbreaks and constant threat to cereal production. Global rice yield declining almost 10-30% including Malaysia. As Magnaphorthe oryzae and its host is model in disease plant study, the rice blast pathosystem has been the subject of intense interest to overcome the importance of the disease to world agriculture. Therefore, in this study, our prime objective was to isolate samples of Magnaphorthe oryzae from diseased leaf obtained from MARDI Seberang Perai, Penang, Malaysia. Molecular identification was performed by sequences analysis from internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes. Phylogenetic affiliation of the isolated samples were analyzed by comparing the ITS sequences with those deposited in the GenBank database. The sequence of the isolate demonstrated at least 99% nucleotide identity with the corresponding sequence in GenBank for Magnaphorthe oryzae. Morphological observed under microscope demonstrated that the structure of conidia followed similar characteristic as M. oryzae. Finding in this study provide useful information for breeding programs, epidemiology studies and improved disease management.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2021

HNRNPUL1 inhibits cisplatin sensitivity of esophageal squamous cell carcinoma through regulating the formation of circMAN1A2

Highlights: • HNRNPUL1 is an independent prognostic factor of ESCC patients receiving platinum-based chemotherapy. • Knockdown of HNRNPUL1 enhances cisplatin sensitivity of ESCC cells. • HNRNPUL1 inhibits the cisplatin sensitivity of ESCC cells by regulating the formation of circMAN1A2. Cisplatin (CDDP) is widely used for chemotherapy of esophageal squamous cell carcinoma (ESCC) but the drug resistance limits its therapeutic benefit. Heterogeneous nuclear ribonucleoprotein U-like 1 (HNRNPUL1) belongs to the family of RNA-binding proteins (RBPs) and is involved in DNA damage repair. To investigate whether and how HNRNPUL1 affects CDDP resistance of ESCC, we evaluated the expression of HNRNPUL1 and found that it was associated with recurrence in ESCC patients receiving postoperative platinum-based chemotherapy and was an independent prognostic factor for disease-free survival (DFS). Besides, we showed that the reduced expression of HNRNPUL1 enhanced the CDDP sensitivity of ESCC cells. Furthermore, RNA immunoprecipitation coupled with high-throughput sequencing (RIP-seq) were performed and a range of HNRNPUL1-binding RNAs influenced by CDDP treatment were identified followed by bioinformatics analysis. In terms of mechanism, we found that HNRNPUL1 inhibited CDDP sensitivity of ESCC cells by regulating the CDDP sensitivity-inhibited circular RNA (circRNA) MAN1A2 formation. Taken together, our results first demonstrated the role of HNRNPUL1 in CDDP resistance of ESCC and suggested that HNRNPUL1 may be a potential target of ESCC chemotherapy.

60 APPLIED LIFE SCIENCES↗
NASA NTRS1995

Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

NASA Discipline Exobiology↗
DOE OSTI2024

A compact stem-loop DNA aptamer targets a uracil-binding pocket in the SARS-CoV-2 nucleocapsid RNA-binding domain

Abstract SARS-CoV-2 nucleocapsid (N) protein is a structural component of the virus with essential roles in the replication and packaging of the viral RNA genome. The N protein is also an important target of COVID-19 antigen tests and a promising vaccine candidate along with the spike protein. Here, we report a compact stem-loop DNA aptamer that binds tightly to the N-terminal RNA-binding domain of SARS-CoV-2 N protein. Crystallographic analysis shows that a hexanucleotide DNA motif (5′-TCGGAT-3′) of the aptamer fits into a positively charged concave surface of N-NTD and engages essential RNA-binding residues including Tyr109, which mediates a sequence-specific interaction in a uracil-binding pocket. Avid binding of the DNA aptamer allows isolation and sensitive detection of full-length N protein from crude cell lysates, demonstrating its selectivity and utility in biochemical applications. We further designed a chemically modified DNA aptamer and used it as a probe to examine the interaction of N-NTD with various RNA motifs, which revealed a strong preference for uridine-rich sequences. Our studies provide a high-affinity chemical probe for the SARS-CoV-2 N protein RNA-binding domain, which may be useful for diagnostic applications and investigating novel antiviral agents.

Biochemistry & Molecular Biology↗
DOE OSTI2017

A compendium of multi-omic sequence information from the Saanich Inlet water column

Marine oxygen minimum zones (OMZs) are widespread regions of the ocean that are currently expanding due to global warming. While inhospitable to most metazoans, OMZs are hotspots for microbial mediated biogeochemical cycling of carbon, nitrogen and sulphur, contributing disproportionately to marine nitrogen loss and climate active trace gas production. Our current understanding of microbial community responses to OMZ expansion is limited by a lack of time-resolved data sets linking multi-omic sequence information (DNA, RNA, protein) to geochemical parameters and process rates. Here, we present six years of time-resolved multi-omic observations in Saanich Inlet, a seasonally anoxic fjord on the coast of Vancouver Island, British Columbia, Canada that undergoes recurring changes in water column oxygenation status. This compendium provides a unique multi-omic framework for studying microbial community responses to ocean deoxygenation along defined geochemical gradients in OMZ waters.

Hawley, Alyse K. (ORCID:0000000235164043)↗