Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “sequence analysis”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 793 records · Page 44
All sourcesNASA NTRSDOE OSTI
DOE OSTI2023

SSGUI v1.0

SSGUI is a web-based application that integrates the integrative genomics browser (IGV) with upstream alignment pipelines enabling rapid analysis of a batch of next-generation sequencing (NGS) samples. The input to SSGUI is an NGS file system directory that is organized by experiment and reference sequence. The output is an online dashboard containing various sequencing statistics for each sample and an integrated IGV plugin enabling rapid analysis of aligned NGS reads.

Kulawik, Mark↗
DOE OSTI2025

Microreactor Assembly Transportation Cask Model Description for Criticality Safety Validation Basis Assessment

Criticality safety analyses are completed on a transportation cask used for microreactor assembly shipment to provide an example of model and analysis to industry for reproducing this type of study on their microreactor fuel shipment. The fuel assembly considered is based on a gas-cooled microreactor (GC-MR), which utilizes HALEU fuel in the form of TRISO particles and utilizes various design options considered in industry designs. Various versions of this GC-MR assembly were studied, with and without YH2 moderator, providing similar conclusions. The shipment cask design is revised based on an existing design ES-3100, developed by Y-12 for the transport of highly enriched uranium (HEU), but is enlarged to hold the GC-MR fuel assembly. Criticality safety analysis for the cask/GC-MR fuel assembly package was performed using the CSAS6 sequence of SCALE6.3.2, utilizing the ENDF/B-VII.1 based continuous energy neutron library, and the analysis strictly follows the guideline from NRC reference reports. Different scenarios, e.g. normal operation, undamaged cask with water flooded, damaged cask with optimal water moderation, have been analyzed and it could be concluded the package would always have a large margin of subcriticality even packed in an infinite array. Sensitivity and similarity analyses are also performed using the TSUNAMI sequence of SCALE6.3.2, and the similarity analysis uses all the experiments from the ICSBEP Handbook with Intermediate and Mixed Enriched Uranium (IEU) and Low Enriched Uranium (LEU) systems together with additional ones that are sponsored by the DNCSH program. These similarity analyses indicate that dry cases have no similar benchmark experiments (ck values greater than 0.8), which may become problematic if more assemblies are shipped together (or a fully loaded core is shipped) and margin to criticality is reduced. However, the damaged cask models with flooded assemblies exhibited similarities to many experiments with ck values greater than 0.8.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗
DOE OSTI2026

Microreactor Assembly Transportation Cask Model Description for Criticality Safety Validation Basis Assessment (Rev. 3)

Criticality safety analyses are completed on a transportation cask used for microreactor assembly shipment to provide an example of model and analysis to industry for reproducing this type of study on their microreactor fuel shipment. The fuel assembly considered is based on a gas-cooled microreactor (GC-MR), which utilizes HALEU fuel in the form of TRISO particles and utilizes various design options considered in industry designs. Various versions of this GC-MR assembly were studied, with and without YH 2 moderator, providing similar conclusions. The shipment cask design is revised based on an existing ES-3100 design, developed by Y-12 for the transport of highly enriched uranium (HEU), but is enlarged to hold the GC-MR fuel assembly. Criticality safety analysis for the cask/GC-MR fuel assembly package was performed using the CSAS6 sequence of SCALE6.3.2, utilizing the ENDF/B-VII.1 based continuous energy neutron library, and the analysis strictly follows the guideline from NRC reference reports. Different scenarios, e.g. normal operation, undamaged cask with water flooded, damaged cask with optimal water moderation, have been analyzed and it could be concluded the package would always have a large margin of subcriticality even packed in an infinite array. Sensitivity and similarity analyses are also performed using the TSUNAMI sequence of SCALE6.3.2, and the similarity analysis uses all the experiments from the ICSBEP Handbook with Highly Enriched Uranium (HEU), Intermediate and Mixed Enriched Uranium (IEU) and Low Enriched Uranium (LEU) systems, together with additional ones that are sponsored by the DNCSH program, and selected IRPhEP experiments using TRISO fuel and graphite moderator. These similarity analyses indicate that the dry nominal design has no similar benchmark experiments (ck values greater than 0.8), which may become problematic if more assemblies are shipped together (or a fully loaded core is shipped) and margin to criticality is reduced. However, the cask models with flooded assemblies exhibited similarities to many experiments with c k values greater than 0.8.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2014

Investigation of phase evolution of CaCu{sub 3}Ti{sub 4}O{sub 12} (CCTO) by in situ synchrotron high-temperature powder diffraction

In situ synchrotron X-ray powder diffraction was used to study the high-temperature phase evolution of CaCu{sub 3}Ti{sub 4}O{sub 12} (CCTO) precursors prepared via solid-state and sol–gel methods. After the precursors are heated to 1225 °C, the CCTO phase is the main phase observed in the calcined powder, with the presence of some minor impurities. Comparing the two precursors, we found that the onset temperature for the CCTO phase formation is 800 °C in the sol–gel precursor, lower than that in the solid-state precursor (875 °C). Intermediate phases were only observed in the sol–gel precursor. Both precursors are able to be calcined to sub-micrometric sized powders. Based on the synchrotron data along with differential scanning calorimetry (DSC) and thermal gravimetric analysis (TGA), the phase formation sequence and mechanism during calcination are proposed in this study. -- Graphical abstract: The in situ synchrotron HT-XRD patterns of CCTO sol–gel and solid-state precursor. Highlights: • Phase formation sequence/mechanism in two CCTO precursors has been established. • Formation temperature of CCTO via sol–gel method is lower than solid-state method. • Intermediate phases are only observed in the sol–gel precursor. • Both precursors are able to be calcined into sub-micrometric sized powders.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2013

Development of an Automated Remedy Performance Evaluation Program - 13622

Performance monitoring is a vital element of groundwater remediation. Unfortunately, the enormous efforts and costs that are expended procuring, managing, processing and storing monitoring data are often not subject to correspondingly rigorous evaluation. This is despite the fact that many steps in the process are predictable and are repeated many times over the remedy life cycle. At the Department of Energy (DOE) Hanford Site, a program is underway to automate many of these steps - processing, formatting any analyzing large volumes of heterogeneous data associated with the operation of several groundwater pump-and-treat (P and T) and in-situ remedies. The Automated Remedy Performance Evaluation Program (ARPEP) was developed from a work-flow process designed to deliver (a) monthly data summaries and preliminary analysis, (b) quarterly performance assessments, and (c) annual roll-up analyses that detect changes in long-term monitoring datasets and support remedy optimization. The intent of the ARPEP is to provide detailed, systematic and traceable data summaries, depictions and analyses that can be used by project scientists to complete their evaluation of remedy performance. The ARPEP work-flow was formalized following extensive review of applicable guidance, regulation and industry standards. The ARPEP incorporates disparate data types collected over different frequencies, such as water levels and pumping rates recorded every minute, and groundwater sample results obtained on quarterly, annual or irregular intervals. The data are processed, reduced to frequencies suitable for assessment, and combined in various ways leading to performance indicators such as (a) pumped well capacities and system downtime that reflect operational performance; (b) hydraulic gradients and areas of hydraulic containment that reflect hydraulic performance; and (c) time-series (longitudinal) and geo-statistical (spatial) trend analyses that reflect progress toward attainment of Remedial Action Objectives (RAOs). The entire sequence of data processing and analysis is undertaken within the R programming environment, an open-source environment for statistical computing and graphics, and is summarized in a comprehensive PDF project report. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Transfer of beef bacterial communities onto food-contact surfaces

Introduction Food spoilage and pathogenic bacteria on food-contact surfaces, especially biofilm-forming strains, can transfer to meats during processing. The objectives of this study were to survey the bacterial communities of beef cuts that transfer onto two commonly used food-contact surfaces, stainless steel (SS) and high-density polyethylene (HDPE) and identify potentially biofilm-forming strains. Methods Top round, flank, chuck, and ground beef were purchased from 3 retail stores. SS and HDPE coupons (approximately 2cm × 5cm) were placed on beef portions (3h, 10°C), after which, the coupons were submerged halfway in PBS (24h, 10°C). Bacteria from the beef cuts and coupon surfaces ( n = 3) were collected, plated on tryptic soy agar plates and incubated (5 days, 25°C). Bacterial isolates were identified by 16S rRNA gene amplicon sequencing and assayed for biofilm formation using a crystal violet binding (CV) assay (72h, 10°C). Additionally, beef and coupon samples were collected for bacterial community analysis by 16S rRNA gene amplicon sequencing. Results and discussion Sixty-one of 972 beef isolates, 29 of 204 HDPE isolates, and 30 of 211 SS isolates were strong biofilm-formers (Absorbance>1.000 at 590 nm in the CV assay). Strong-binding isolates identified were of the genera Pseudomonas , Acinetobacter , Psychrobacter , Carnobacterium , and Brochothrix . Coupon bacterial communities among stores and cuts were distinct ( p < 0.001, PERMANOVA), but there was no distinction between the communities found on HDPE or SS coupons ( p > 0.050, PERMANOVA). The bacterial communities identified on the coupons may help determine the communities capable of transferring and colonizing onto surfaces, which can subsequently cross-contaminate foods.

Guron, Giselle K. P.↗
DOE OSTI2025

The role of soil chemical properties and microbial communities on Dendrocalamus brandisii bamboo shoot quality, Yunnan Province, China

Objective To explore the effects of soil nutrients and microbial communities on the quality of Dendrocalamus brandisii shoots in different regions, providing a scientific basis for their development and utilization. Methods Using seven different geographic sources of D. brandisii from Yunnan Province as research subjects, this study employs chemical analysis and high-throughput sequencing to reveal the relationship between soil nutrients, microbial functional groups, and the nutritional quality of bamboo shoots. Results The results indicate that there are significant differences in soil nutrient content among the regions ( p < 0.05), with bamboo shoots from Baoshan Changning (CN) exhibiting the best overall nutritional quality. The key factors influencing bacterial community changes include pH, available phosphorus (AP), and available potassium (AK). In contrast, the main factors affecting fungal community changes are pH, soil organic matter (SOM), available potassium (AK), and total nitrogen (TN). This version maintains clarity and logical flow, making it easier for readers to understand the different factors influencing bacterial and fungal community changes. The diversity indices of soil microbial communities among different sources of Dendrocalamus brandisii show significant differences ( p < 0.05). The dominant groups in the seven regions include Proteobacteria, Acidobacteriota, Actinobacteriota, Chloroflexi, Ascomycota, and Basidiomycota. The soil microbial community in Baoshan Changning (CN) shows significant structural differences compared to the other six regions, with the highest relative abundances of Chloroflexi and Acidobacteriota. In contrast, the highest relative abundance of Proteobacteria is found in Honghe Shiping (SP), while Actinobacteriota has the highest relative abundance in Yuxi Xinping (XP). RDA analysis indicates that soil nutrients (SOM, pH, AP, TN) affect the water content, soluble sugar, and crude fat of bamboo shoots. Additionally, the bacterial communities including Actinobacteriota, Chloroflexi, Patescibacteria, GAL15, and Cyanobacteria influence the water content, soluble sugar, ash content, protein, and lignin of bamboo shoots. Discussion In the fungal community, Basidiomycota, Kickxellomycota, Mucoromycota, unclassified-k-Fungi, and Glomeromycota affect the water content and tannin levels in bamboo shoots. In summary, soil nutrients and soil microorganisms are interconnected and work together to influence the quality of bamboo shoots.

Chen, Qian↗
DOE OSTI2012

Comparative Genomics of Early-Diverging Brucella Strains Reveals a Novel Lipopolysaccharide Biosynthesis Pathway

Abstract: Brucella species are Gram-negative bacteria that infect mammals. Recently, two unusual strains (Brucella inopinata BO1 T and B. inopinata-like BO2) have been isolated from human patients, and their similarity to some atypical brucellae isolated from Australian native rodent species was noted. Here we present a phylogenomic analysis of the draft genome sequences of BO1 T and BO2 and of the Australian rodent strains 83-13 and NF2653 that shows that they form two groups well separated from the other sequenced Brucella spp. Several important differences were noted. Both BO1 T and BO2 did not agglutinate significantly when live or inactivated cells were exposed to monospecific A andMantisera against O-side chain sugars composed of N-formyl-perosamine. While BO1 T maintained the genes required to synthesize a typical Brucella O-antigen, BO2 lacked many of these genes but still produced a smooth LPS (lipopolysaccharide). Most missing genes were found in the wbk region involved in O-antigen synthesis in classic smooth Brucella spp. In their place, BO2 carries four genes that other bacteria use for making a rhamnose-based O-antigen. Electrophoretic, immunoblot, and chemical analyses showed that BO2 carries an antigenically different O-antigen made of repeating hexose-rich oligosaccharide units that made the LPS water-soluble, which contrasts with the homopolymeric O-antigen of other smooth brucellae that have a phenol-soluble LPS. The results demonstrate the existence of a group of early-diverging brucellae with traits that depart significantly from those of the Brucella species described thus far. Importance: This report examines differences between genomes from four new Brucella strains and those from the classic Brucella spp. Our results show that the four new strains are outliers with respect to the previously known Brucella strains and yet are part of the genus, forming two new clades. The analysis revealed important information about the evolution and survival mechanisms of Brucella species, helping reshape our knowledge of this important zoonotic pathogen. One discovery of special importance is that one of the strains, BO2, produces an O-antigen distinct from any that has been seen in any other Brucella isolates to date.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

High throughput, accurate gene annotation through AI and HPC-enabled structural analysis

With the advances in next generation sequencing technologies, the number of sequenced genomes is growing exponentially, resulting in a technology bottleneck for the translation of sequence information into usable hypotheses about the function of each gene. We have proposed leveraging our leadership high-performance computing (HPC) resources to help break this annotation bottleneck. Here we design an HPC-based framework to infer gene function from gene sequence by incorporating information about protein structure and interactions predicted by deep learning approaches. Accurate functional prediction and gene annotation using computational methods will facilitate breakthroughs in the genomic sciences essential to understanding and harnessing life processes in bacteria, fungi and plants. The development and applications of the state-of-the-art deep neural networks to protein structural modeling, interaction prediction, sequence comparison, and quality assessment of protein structural models will be made possible by leadership computational resources. These HPC-enabled bioinformatics and molecular modeling tools will provide powerful insights into molecular functions of genes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Delayed access to feed early post-hatch affects the development and maturation of gastrointestinal tract microbiota in broiler chickens

Background: The first two weeks of post-hatch (PH) growth in broilers (meat-type birds) are critical for gut development and microbiota colonization. In the current broiler production system, chicks may not receive feed and water for 24 to 72 h due to variations in hatching time and hatchery management. Post-hatch feed delay affects body weight, feed efficiency, mortality, and gut development. The goal of this study was to investigate changes in the microbiome in broiler chickens early PH and the effect of delayed access to feed on the microbiota. Results: Chicks either received feed and water immediately after hatch or access to feed was delayed for 48 h to mimic commercial hatchery settings (treatment, TRT). Both groups were sampled (n = 6) at -48, 0, 4 h, and 1 (24 h), 2 (48 h), 3 (72 h), 4 (96 h), 6 (144 h), 8 (192 h), 10 (240 h), 12 (288 h) and 14 (336 h) days PH. Ileal (IL) and cecal (CE) epithelial scrapings (mucosal bacteria, M) and digesta (luminal bacteria, L) were collected for microbiota analysis. Microbiota was determined by sequencing the V3-V4 region of bacterial 16S rRNA and analyzed using QIIME2. The microbiota of early ileal and cecal samples were characterized by high abundance of unclassified bacteria. Among four bacterial populations (IL-L, IL-M, CE-L, CE-M), IL-M was the least affected by delayed access to feed early PH. Both alpha and beta diversities were affected by delayed access to feed PH in IL-L, CE-M and CE-L. However, the development effect was more pronounced. In all four bacterial populations, significant changes due to developmental effect (time relative to hatch) was observed in taxonomic composition, with transient changes of bacterial taxa during the first two weeks PH. Delayed access to feed has limited influence on bacterial composition with only a few genera and species affected in all four bacterial populations. Predicted function based on 16S rRNA was also affected by delayed access to feed PH with most changes in metabolic pathway richness observed in IL-L, CE-L and CE-M. Conclusions: These results show transient changes in chicken microbiota biodiversity during the first two weeks PH and indicate that delayed access to feed affects microbiota development. Proper microbiota development could be an important factor in disease prevention and antibiotic use in broiler chickens. Moreover, significant differences in response to delayed access to feed PH between luminal and mucosal bacterial populations strongly suggests the need for separate analysis of these two populations.

16S↗
DOE OSTI2017

On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2012

Evolutionary Drift Models for Moving Target Defense

One of the biggest challenges faced by cyber defenders is that attacks evolve more rapidly than our ability to recognize them. We propose a moving target defense concept in which the means of detection is set in motion. This is done by moving away from static signature-based detection and instead adopting biological modeling techniques that describe families of related sequences. We present here one example for how to apply evolutionary models to cyber sequences, and demonstrate the feasibility of this technique on analysis of a complex, evolving software project. Specifically, we applied sequence-based and profile-based evolutionary models and report the ability of these models to recognize highly volatile code regions. We found that different drift models reliably identify different types of evolutionarily related code regions. The impact is that these (and possibly other) evolutionary models could be used in a moving target defense in which the "signature" being used to detect sequence-based behaviors is not a fixed signature but one that can recognize new variants of a known family based on multiple evolutionary models.

Oehmen, Christopher S.↗
DOE OSTI2021

Extension of SCALE/Sampler’s sensitivity analysis

Nuclear data are a major source of uncertainties in reactor physics calculations. The propagation of nuclear data uncertainties to important system responses is instrumental when determining appropriate safety margins in reactor safety analyses. It is also important to understand the major contributors to the observed uncertainties to make recommendations for further measurements and evaluations and aid in the understanding of the studied system. The SCALE code system allows for nuclear data uncertainty analysis based on the random sampling approach as implemented in SCALE’s Sampler sequence. Sampler was recently extended by a sensitivity analysis in terms of the calculation of two correlation-based sensitivity indices. This analysis allows for the identification of the top contributing nuclear reactions to any analyzed output uncertainty. This paper presents the sensitivity indices, along with their interpretation and limitations. It demonstrates the application in an eigenvalue and decay heat analysis for a boiling water reactor fuel assembly.

46 INSTRUMENTATION RELATED TO NUCLEAR SCIENCE AND ↗
DOE OSTI2023

Derivatization of Mirror-Image L -Nucleic Acids with 2'-OMe Modification for Thermal and Structural Stabilization

To further expand the functionality and enhance the stability of mirror-image nucleic acids as advanced agents for basic research and therapeutic design, we have synthesized 2'-deoxy-2'-methoxy- L -uridine phosphoramidite and incorporated it into L -DNA and L -RNA by solid-phase synthesis quantitatively. We found that the thermostability of L -nucleic acids is dramatically improved after introducing the modifications. Moreover, we successfully crystallized both L -DNA and L -RNA duplexes containing the 2'-OMe modifications and sharing identical sequences. Crystal structure determination and analysis revealed the overall structures of the mirror-image nucleic acids, and for the first time it was possible to interpret the structural deviations caused by 2'-OMe and 2'-OH groups in the oligonucleotides, which are very similar. In conclusion, this novel chemical nucleic acid modification has the potential to be used to design nucleic acid-based therapeutics and materials in the future.

2'-OMe-modifications↗
DOE OSTI2023

A cellular selection identifies elongated flavodoxins that support electron transfer to sulfite reductase

Flavodoxins (Flds) mediate the flux of electrons between oxidoreductases in diverse metabolic pathways. To investigate whether Flds can support electron transfer to a sulfite reductase (SIR) that evolved to couple with a ferredoxin, we evaluated the ability of Flds to transfer electrons from a ferredoxin-NADP reductase (FNR) to a ferredoxin-dependent SIR using growth complementation of an Escherichia coli strain with a sulfur metabolism defect. We show that Flds from cyanobacteria complement this growth defect when coexpressed with an FNR and an SIR that evolved to couple with a plant ferredoxin. When we evaluated the effect of peptide insertion on Fld-mediated electron transfer, we observed a sensitivity to insertions within regions predicted to be proximal to the cofactor and partner binding sites, while a high insertion tolerance was detected within loops distal from the cofactor and within regions of helices and sheets that are proximal to those loops. Bioinformatic analysis showed that natural Fld sequence variability predicts a large fraction of the motifs that tolerate insertion of the octapeptide SGRPGSLS. In conclusion, these results represent the first evidence that Flds can support electron transfer to assimilatory SIRs, and they suggest that the pattern of insertion tolerance is influenced by interactions with oxidoreductase partners.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2018

Association of Vampirovibrio chlorellavorus with decline and death of Chlorella sorokiniana in outdoor reactors

The outdoor ARID raceway was established for optimizing the cultivation of microalgae for biofuel production. During the summers of 2014 and 2015, discoloration was observed in cultures of Chlorella sorokiniana , which shifted from a vibrant green color to yellow, followed by cell clumping, decline in density, and rapid death, resulting in 40–60% reduced biomass production. To investigate, total DNA was purified from the raceway samples and subjected to polymerase chain reaction (PCR) amplification using degenerate primers that amplify the 16S rRNA gene of eubacteria. BLASTn analysis of the cloned amplicon sequences revealed the presence of the Gram-negative, predatory bacterium, Vampirovibrio chlorellavorus . Scanning electron microscopic examination showed an abundance of coccoid cells, 0.3–0.6 μm in diameter, some of which were attached to C. sorokiniana cells. PCR amplification indicated the presence of V. chlorellavorus in raceway vessels, water lines, connective tubing, and in early, scaled-up DOE1412 cultures used to inoculate the raceway. Based on PCR detection, the decontamination of the equipment and water line with "Wal-Clean" more effectively eliminated V. chlorellavorus and delayed the onset of attack, compared to the chlorine disinfectant, trichloromelamine (TCM). Total DNA was isolated from soil samples collected monthly from the nearby Rillito River during 2014–2015 and subjected to PCR amplification using primers designed to amplify the 16S rRNA and 18S rRNA gene of V. chlorellavorus and C. sorokiniana , respectively. Results indicated that V. chlorellavorus and Chlorella spp. were present in most of the riverbed samples nearly year round, suggesting a possible naturally occurring reservoir of the predatory bacterium.

59 BASIC BIOLOGICAL SCIENCES↗