Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “Base Sequence”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 793 records · Page 44
All sourcesNASA NTRSDOE OSTI
DOE OSTI2024

Library Screening, In Vivo Confirmation, and Structural and Bioinformatic Analysis of Pentapeptide Sequences as Substrates for Protein Farnesyltransferase

Protein farnesylation is a post-translational modification where a 15-carbon farnesyl isoprenoid is appended to the C-terminal end of a protein by farnesyltransferase (FTase). This process often causes proteins to associate with the membrane and participate in signal transduction pathways. The most common substrates of FTase are proteins that have C-terminal tetrapeptide CaaX box sequences where the cysteine is the site of modification. However, recent work has shown that five amino acid sequences can also be recognized, including the pentapeptides CMIIM and CSLMQ. In this work, peptide libraries were initially used to systematically vary the residues in those two parental sequences using an assay based on Matrix Assisted Laser Desorption Ionization–Mass Spectrometry (MALDI-MS). In addition, 192 pentapeptide sequences from the human proteome were screened using that assay to discover additional extended CaaaX-box motifs. Selected hits from that screening effort were rescreened using an in vivo yeast reporter protein assay. The X-ray crystal structure of CMIIM bound to FTase was also solved, showing that the C-terminal tripeptide of that sequence interacted with the enzyme in a similar manner as the C-terminal tripeptide of CVVM, suggesting that the tripeptide comprises a common structural element for substrate recognition in both tetrapeptide and pentapeptide sequences. Molecular dynamics simulation of CMIIM bound to FTase further shed light on the molecular interactions involved, showing that a putative catalytically competent Zn(II)-thiolate species was able to form. Bioinformatic predictions of tetrapeptide (CaaX-box) reactivity correlated well with the reactivity of pentapeptides obtained from in vivo analysis, reinforcing the importance of the C-terminal tripeptide motif. This analysis provides a structural framework for understanding the reactivity of extended CaaaX-box motifs and a method that may be useful for predicting the reactivity of additional FTase substrates bearing CaaaX-box sequences.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Machine learning-based prediction of enzyme substrate scope: Application to bacterial nitrilases

Predicting the range of substrates accepted by an enzyme from its amino acid sequence is challenging. Although sequenc- and structure-based annotation approaches are often accurate for predicting broad categories of substrate specificity, they generally cannot predict which specific molecules will be accepted as substrates for a given enzyme, particularly within a class of closely related molecules. Combining targeted experimental activity data with structural modeling, ligand docking, and physicochemical properties of proteins and ligands with various machine learning models provides complementary information that can lead to accurate predictions of substrate scope for related enzymes. Here we describe such an approach that can predict the substrate scope of bacterial nitrilases, which catalyze the hydrolysis of nitrile compounds to the corresponding carboxylic acids and ammonia. Each of the four machine learning models (logistic regression, random forest, gradient-boosted decision trees, and support vector machines) performed similarly (average ROC = 0.9, average accuracy = ~82%) for predicting substrate scope for this dataset, although random forest offers some advantages. Finally, this approach is intended to be highly modular with respect to physicochemical property calculations and software used for structural modeling and docking.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Bidirectional titration of yeast gene expression using a pooled CRISPR guide RNA approach

Most classic genetic approaches utilize binary modifications that preclude the identification of key knockdowns for essential genes or other targets that only require moderate modulation. As a complementary approach to these classic genetic methods, we describe a plasmid-based library methodology that affords bidirectional, graded modulation of gene expression enabled by tiling the promoter regions of all 969 genes that comprise the ito977 model of Saccharomyces cerevisiae’s metabolic network. When coupled with a CRISPR-dCas9–based modulation and next-generation sequencing, this method affords a library-based, bidirection titration of gene expression across all major metabolic genes. We utilized this approach in two case studies: growth enrichment on alternative sugars, glycerol and galactose, and chemical overproduction of betaxanthins, leading to the identification of unique gene targets. In particular, we identify essential genes and other targets that were missed by classic genetic approaches.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

deeprob/ThioesteraseEnzymeSpecificity: EnZymClass-first-release

Characterizing the functional properties of plant acyl-ACP thioesterases (TEs), a key enzyme class used in the production of renewable oleochemicals in microbial hosts, experimentally, can be an expensive and time consuming process since it requires manual screening of thousands of candidates in a database. Using amino acid sequence to computationally predict an enzyme’s function might accelerate this process; however obtaining the necessary amount of information on previously characterized enzymes and their respective sequences required by standard Machine Learning (ML) based approaches to accurately infer sequence-function relationships can be prohibitive, especially with a low-throughput testing cycle. Experimental noise, unbalanced dataset where high sequence similarity does not always imply identical functional properties will further prevent robust prediction performance. Herein we present a ML method, Ensemble method for enZyme Classification (EnZymClass), that is specifically designed to address these issues. We used EnZymClass to classify TEs into short, long and mixed free fatty acid substrate specificity categories. While general guidelines for inferring substrate specificity have been proposed before, prediction of chain-length preference from primary sequence has remained elusive for plant acyl-ACP TEs. By applying EnZymClass to a subset of TEs in the ThYme database, we identified two medium chain TEs, ClFatB3 and CwFatB2, with previously uncharacterized activity in E. coli fatty acid production hosts.

Banerjee, Deepro↗
NASA NTRS2007

SPARTAN: A High-Fidelity Simulation for Automated Rendezvous and Docking Applications

bd Systems (a subsidiary of SAIC) has developed the Simulation Package for Autonomous Rendezvous Test and ANalysis (SPARTAN), a high-fidelity on-orbit simulation featuring multiple six-degree-of-freedom (6DOF) vehicles. SPARTAN has been developed in a modular fashion in Matlab/Simulink to test next-generation automated rendezvous and docking guidance, navigation,and control algorithms for NASA's new Vision for Space Exploration. SPARTAN includes autonomous state-based mission manager algorithms responsible for sequencing the vehicle through various flight phases based on on-board sensor inputs and closed-loop guidance algorithms, including Lambert transfers, Clohessy-Wiltshire maneuvers, and glideslope approaches The guidance commands are implemented using an integrated translation and attitude control system to provide 6DOF control of each vehicle in the simulation. SPARTAN also includes high-fidelity representations of a variety of absolute and relative navigation sensors that maybe used for NASA missions, including radio frequency, lidar, and video-based rendezvous sensors. Proprietary navigation sensor fusion algorithms have been developed that allow the integration of these sensor measurements through an extended Kalman filter framework to create a single optimal estimate of the relative state of the vehicles. SPARTAN provides capability for Monte Carlo dispersion analysis, allowing for rigorous evaluation of the performance of the complete proposed AR&D system, including software, sensors, and mechanisms. SPARTAN also supports hardware-in-the-loop testing through conversion of the algorithms to C code using Real-Time Workshop in order to be hosted in a mission computer engineering development unit running an embedded real-time operating system. SPARTAN also contains both runtime TCP/IP socket interface and post-processing compatibility with bdStudio, a visualization tool developed by bd Systems, allowing for intuitive evaluation of simulation results. A description of the SPARTAN architecture and capabilities is provided, along with details on the models and algorithms utilized and results from representative missions.

Turbe, Michael A.↗
DOE OSTI2015

SU-E-T-761: TOMOMC, A Monte Carlo-Based Planning VerificationTool for Helical Tomotherapy

Purpose: Present a new Monte Carlo code (TOMOMC) to calculate 3D dose distributions for patients undergoing helical tomotherapy treatments. TOMOMC performs CT-based dose calculations using the actual dynamic variables of the machine (couch motion, gantry rotation, and MLC sequences). Methods: TOMOMC is based on the GEPTS (Gama Electron and Positron Transport System) general-purpose Monte Carlo system (Chibani and Li, Med. Phys. 29, 2002, 835). First, beam models for the Hi-Art Tomotherpy machine were developed for the different beam widths (1, 2.5 and 5 cm). The beam model accounts for the exact geometry and composition of the different components of the linac head (target, primary collimator, jaws and MLCs). The beams models were benchmarked by comparing calculated Pdds and lateral/transversal dose profiles with ionization chamber measurements in water. See figures 1–3. The MLC model was tuned in such a way that tongue and groove effect, inter-leaf and intra-leaf transmission are modeled correctly. See figure 4. Results: By simulating the exact patient anatomy and the actual treatment delivery conditions (couch motion, gantry rotation and MLC sinogram), TOMOMC is able to calculate the 3D patient dose distribution which is in principal more accurate than the one from the treatment planning system (TPS) since it relies on the Monte Carlo method (gold standard). Dose volume parameters based on the Monte Carlo dose distribution can also be compared to those produced by the TPS. Attached figures show isodose lines for a H&N patient calculated by TOMOMC (transverse and sagittal views). Analysis of differences between TOMOMC and TPS is an ongoing work for different anatomic sites. Conclusion: A new Monte Carlo code (TOMOMC) was developed for Tomotherapy patient-specific QA. The next step in this project is implementing GPU computing to speed up Monte Carlo simulation and make Monte Carlo-based treatment verification a practical solution.

60 APPLIED LIFE SCIENCES↗
NASA NTRS1985

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

Villanueva, E.↗
DOE OSTI2023

Integrated Process Optimization for Biochemical Conversion

This research is motivated by the challenges faced during biomass processing in bioenergy plants. It has been observed that variations in biomass characteristics, such as moisture, ash, and carbohydrate contents cause variations in feeding of the system which led to underutilization of equipment and the reactor. The objective of this research is to ensure a continuous flow of biomass to the reactor in plants that use the biochemical conversion process to generate liquid fuels. The overall goal is to lower the cost of producing biofuels, which could lead to improving US’s energy independency and growing US’s rural economy. The research team developed analytical models, such as discrete element method (DEM) models and mathematical models. The DEM models are unit-level models that explicitly capture biomass characteristics and quantify the impacts of biomass characteristics on bulk material properties and the performance of specific equipment. The mathematical models are system-level models that capture the impacts of system infeed rate, equipment processing rate, storage location and capacity, and biomass characteristics on system throughput. The functional relations predicting the bulk material properties from DEM models are incorporated to the mathematical models. The models developed were validated and evaluated using data collected at Idaho National Laboratory’s biomass processing facility. Via these models, we identified process control strategies that ensure a continuous flow of biomass to the reactor, while meeting the requirements of biochemical conversion process. Our analysis indicates that sequencing of biomass bales based on moisture level, and carbohydrate contents could have a positive impact on reducing processing time and inventory level and increasing throughput rate. Short bale sequences that repeat frequently, seem to have the greatest impact on improving system’s performance. Based on our experiments, the total annual system operating costs reduced by 20-30%, and the maximum inventory level reduced by 3 to 4 times. The operating costs include the annual equipment amortization cost and processing cost. The implementation of the models developed requires the use of standardized bale format, Radio Frequency Identification technology, sensing and real time monitoring of material attributes, automated material handling equipment, and automated process control. The scope of the model proposed can be extended to include the whole supply chain. The supply chain models help identify how many bales of different biomass feedstock to purchase given biomass availability in the region, biomass price and quality, and the biomass processing capabilities of the biorefinery. Thus, the outcomes of supply chain models can be used to inform the design of long-term contracts among farmers and the biorefinery.

09 BIOMASS FUELS↗
DOE OSTI2019

Magnetic resonance elastography SE-EPI vs GRE sequences at 3T in a pediatric population with liver disease

Purpose: The goal of our study is to compare hepatic stiffness measures using gradient-recalled echo (GRE) versus spin-echo echo planar imaging (SE-EPI)-based MR Elastography (MRE) at 3T used to measure hepatic stiffness in a patients with suspected liver diseases. Materials and methods: This retrospective study included 52 patients with liver disease who underwent a 3T MRE exam including both an investigational SE-EPI-based technique and a product GRE-based technique. Regions of interest (ROI) were placed on the elastograms to measure elastography-derived liver stiffness as well as the area included within the ROIs. The mean liver stiffness values and area of ROIs were compared. Results: The mean liver stiffness was 3.72 kilopascal (kPa) ± 1.29 using GRE MRE and 3.78 kPa ± 1.13 using SE-EPI MRE. Measurement of liver stiffness showed excellent agreement between the two pulse sequences with a mean bias of − 0.1 kPa (range − 1.8 to 1.7 kPa) between sequences. The mean measurable ROI area was higher with SE-EPI (313.8 cm{sup 2} ± 213.8) than with the GRE technique (208.6 cm{sup 2} ± 114.8), and the difference was statistically significant (P < 0.05). Conclusions: Our data shows excellent agreement of measured liver stiffness between GRE and SE-EPI-based sequences at 3T. Our results show the advantage of a SE-EPI MRE sequence in terms of image quality, ROI size and acquisition time with equivalent liver stiffness measurements as compared to GRE-MRE sequence.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2017

ClusterCAD: a computational platform for type I modular polyketide synthase design

Here, we present ClusterCAD, a web-based toolkit designed to leverage the collinear structure and deterministic logic of type I modular polyketide synthases (PKSs) for synthetic biology applications. The unique organization of these megasynthases, combined with the diversity of their catalytic domain building blocks, has fueled an interest in harnessing the biosynthetic potential of PKSs for the microbial production of both novel natural product analogs and industrially relevant small molecules. However, a limited theoretical understanding of the determinants of PKS fold and function poses a substantial barrier to the design of active variants, and identifying strategies to reliably construct functional PKS chimeras remains an active area of research. In this work, we formalize a paradigm for the design of PKS chimeras and introduce ClusterCAD as a computational platform to streamline and simplify the process of designing experiments to test strategies for engineering PKS variants. ClusterCAD provides chemical structures with stereochemistry for the intermediates generated by each PKS module, as well as sequence- and structure-based search tools that allow users to identify modules based either on amino acid sequence or on the chemical structure of the cognate polyketide intermediate. ClusterCAD can be accessed at https://clustercad.jbei.org and at http://clustercad.igb.uci.edu.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2014

Coarse-grained modeling of DNA oligomer hybridization: Length, sequence, and salt effects

A recently-published coarse-grained DNA model [Hinckley, D. M. et al, J. Chem. Phys. 139, 144903 (2013)] is used to study the hybridization mechanism of DNA oligomers. Forward flux sampling is used to construct ensembles of reactive trajectories from which the effects of sequence, length, and ionic strength are revealed. Heterogeneous sequences are observed to hybridize via the canonical zippering mechanism. In contrast, homogeneous sequences hybridize through a slithering mechanism, while more complex base pair displacement processes are observed for repetitive sequences. In all cases the formation of non-native base pairs leads to an increase in the observed hybridization rate constants beyond those observed in sequence where only native base pairs are permitted. The scaling of rate constants with length is captured by extending existing hybridization theories to account for the formation of non-native base pairs. Furthermore, that scaling is found to be similar for oligomeric and polymeric systems, suggesting that similar physics are involved.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2019

Impact of Blend Proportion on the Miscibility and Thermal Characteristics of Synthetic Plastic-Derived Polypentapeptide with Commercially Available Polyvinyl Alcohol

Plastic-based polypeptides are versatile entities formed to conceive a broad range of scaffold biomaterials. They possess distinct, repetitive, hydrophobic sequences that confer conservation, reversibility, temperature-dependent self-association and dissociation properties. The repeating sequence of plastic-based peptides, poly(AVGVP) have been synthesized by the solution phase method and characterized by {sup 13}C and {sup 1}H-NMR spectroscopy. The intermolecular interactions between poly(AVGVP) and polyvinyl alcohol (PVA) was explored in solution and solid phase by diverse analytical methods. The interaction parameters, namely; α, β, µ and ∆[η]{sub m} obtained from the dilute solution viscometric approach, unveiled that the two polymers were miscible up to 40% of the polypeptide in the blends. Besides, Fourier transform infrared (FTIR) spectroscopy authenticated the formation of strong intermolecular hydrogen bonds connecting blend networks. Further, other analytical techniques such as DSC, SEM and XRD probes advocated the miscibility results. Thermogravimetric investigation of the blends confirmed the proportionate decrease of the thermal stability with the increase of polypentapeptide, attributable to the intermolecular amalgamation between the polypeptide and PVA. The blends and plain poly(AVGVP) degraded completely at about 700 °C, whereas the virgin PVA was about only 60% at this temperature. Graphic Abstract: .

36 MATERIALS SCIENCE↗
DOE OSTI2018

Draft Genome Sequence of Pseudomonas sp. Strain B1, Isolated from a Contaminated Sediment

ABSTRACT The draft genome sequence of Pseudomonas sp. strain B1, isolated from a contaminated soil, is reported. The genome comprises 6,706,934 bases, 6,059 coding sequences, and 70 RNAs and has a G+C content of 60.3%. A suite of biodegradative genes, many located on genomic islands, were identified from strain B1, further enhancing our understanding of the versatile pseudomonads.

59 BASIC BIOLOGICAL SCIENCES↗