Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “factorization”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 703 records · Page 39
All sourcesNASA NTRSDOE OSTI
DOE OSTI2018

A Guide for Selecting Appropriate Human Factors Methods and Measures in Control Room Modernization Efforts in Nuclear Power Plants

Abstract. Many of the U.S. nuclear power plants are approaching the end of their 60-year licensing period. The U.S. Department of Energy Light Water Reactor Sustainability Program is conducting targeted research to extend the lives and ensure long-term reliability, productivity, safety, and security of these plants through targeted research, such as with integrating advanced digital instrumentation and control technologies in the main control room. There are many challenges to this, one being the integration of human factors engineering in the design and evaluation of these upgrades. This paper builds upon recent efforts in developing utility-specific guidance for integrating human factors engineering in the control room modernization process by providing commonly used data collection methods that are applicable at various phases of the upgrade process. Advantages and disadvantages of each method is provided for consideration of an optimal human factors evaluation plan to be used throughout the lifespan of the upgrade process.

99 GENERAL AND MISCELLANEOUS↗
DOE OSTI2017

Human Factors Principles in Information Dashboard Design - 278

Refueling outages remain one of the largest opportunities for improving capacity factor and reducing costs available to commercial nuclear power plants. Although the nuclear industry has made steady improvement in outage optimization, each day of a refueling outage still represents an opportunity to save millions of dollars and each day an outage extends past its planned end date represents millions of dollars that may have been spent unnecessarily. Reducing planned outage duration or preventing outage extensions requires careful management of the outage schedule as well as constant oversight and monitoring of work completion during the outage execution. During a typical outage, there are typically more than 10,000 activities on the schedule that, if not managed efficiently, may cause expensive outage delays. Management of outages currently relies largely on paper-based resources and general-purpose office software. A typical method currently used to monitor work performance is a burn-down curve, where total remaining activities are plotted against the baseline schedule to track bulk work completion progress. While methods like this are useful, there is still considerable uncertainty during a typical outage whether bulk work progress is adequate and therefore a lot of management time is spent analyzing the situation on a daily basis. This paper is a case study of how new technology, in combination with established human-factors and user-centered design knowledge, can be used to support Outage Control Center (OCC) personnel decision making. In particular, we describe recent advances made in developing a framework for the design of visual outage information presentation, as well as an overview of the human factors principles that informed the development of the visualizations. To test the utility of advanced visual outage information presentation, an outage management dashboard software application was created as part of the Department of Energy's Advanced Outage Control Center project (AOCC). This dashboard is intended to present all the critical information an outage manager would need to understand the current status of a refueling outage. The dashboard presents the critical path, bulk work performance, key performance indicators, outage milestones and metrics relating current performance to historical performance. Additionally, the dashboard includes data analysis tools to allow outage managers to drill down into the underlying data to understand the drivers of the indicators. (authors)

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2022

Biomass formation and sugar release efficiency of Populus modified by altered expression of a NAC transcription factor

Woody biomass is an important feedstock for biofuel production. Manipulation of wood properties that enable efficient conversion of biomass to biofuel reduces cost of biofuel production. Wood cell wall composition is regulated at several levels that involve expression of transcription factors such as wood-/secondary cell wall-associated NAC domains (WND or SND). In Arabidopsis thaliana, SND1 regulates cell wall composition through activation of its down-stream targets such as MYBs. The functional aspects of SND1 homologs in the woody Populus have been studied through transgenic manipulation. In this study, we investigated the role of PdWND1B, Populus SND1 sequence ortholog, in wood formation using transgenic manipulation through over-expression or silencing under the control of a vascular-specific 4-coumarate-CoA ligase (4CL) promoter. As compared with control plants, PdWND1B-RNAi plants were shorter in height, with significantly reduced stem diameter and dry biomass, whereas there were no significant differences in growth and productivity of PdWND1B over-expression plants. Conversely, PdWND1B over-expression lines showed a significant reduction in cellulose and increase in lignin content, whereas there was no significant impact on lignin content of downregulated lines. Stem carbohydrate composition analysis revealed a decrease in glucose, mannose, arabinose, and galactose, but an increase in xylose in the over-expression lines. Transcriptome analysis revealed upregulation of several downstream transcription factors and secondary cell wall related structural genes in the PdWND1B over-expression lines, partly explaining the observed phenotypic changes in cell wall chemistry. Relative to the control, glucose release efficiency and ethanol production from stem biomass was significantly reduced in over-expression lines. Our results show that PdWND1B is an important factor determining biomass productivity, cell wall chemistry and its conversion to biofuels in Populus.

09 BIOMASS FUELS↗
DOE OSTI2024

Flavor fragmentation function factorization

A definition of partonic jet flavor that is both theoretically well-defined and experimentally robust would have profound implications for measurements and predictions especially for heavy flavor applications. Recently, a definition of jet flavor was introduced as the net flavor flowing along the direction of the Winner-Take-All axis of a jet which is soft safe to all orders, but not collinear safe. Here, we exploit the lack of collinear safety and propose a factorization theorem of perturbative flavor fragmentation functions that resum collinear divergences and describe the evolution of flavor from the short distance of jet production to the long distance at which hadronization occurs. Collinear flavor evolution is governed by a small modification of the DGLAP equations. We present a detailed all-orders analysis and identify exact relations that must hold amongst the various anomalous dimensions by probability conservation and the existence of fixed points of the renormalization group flow. We explicitly validate the factorization theorem at one-loop order, and demonstrate its consistency at two loops in particular flavor channels. Starting at two-loops, constraints on phase space imposed by flavor measurements potentially allow for non-trivial soft contributions, but we demonstrate that they are scaleless and so explicitly vanish, ensuring that soft particles are summed inclusively and all divergences are exclusively collinear in nature. This factorization theorem opens the door to precision calculations with identified flavor in the infrared.

72 PHYSICS OF ELEMENTARY PARTICLES AND FIELDS↗
DOE OSTI2022

Factorization connecting continuum & lattice TMDs

Transverse-momentum-dependent parton distribution functions (TMDs) can be studied from first principles by a perturbative matching onto lattice-calculable quantities: so-called lattice TMDs, which are a class of equal-time correlators that includes quasi-TMDs and TMDs in the Lorentz-invariant approach. We introduce a general correlator that includes as special cases these two Lattice TMDs and continuum TMDs, like the Collins scheme. Then, to facilitate the derivation of a factorization relation between lattice and continuum TMDs, we construct a new scheme, the Large Rapidity (LR) scheme, intermediate between the Collins and quasi-TMDs. The LR and Collins schemes differ only by an order of limits, and can be matched onto one another by a multiplicative kernel. We show that this same matching also holds between quasi and Collins TMDs, which enables us to prove a factorization relation between these quantities to all orders in α s . Our results imply that there is no mixing between various quark flavors or gluons when matching Collins and quasi TMDs, making the lattice calculation of individual flavors and gluon TMDs easier than anticipated. We cross-check these results explicitly at one loop and discuss implications for other physical-to-lattice scheme factorizations.

72 PHYSICS OF ELEMENTARY PARTICLES AND FIELDS↗
DOE OSTI2022

Perturbative calculations of gravitational form factors at large momentum transfer

We perform a perturbative QCD analysis of the gravitational form factors (GFFs) of nucleon at large momentum transfer. We derive the explicit factorization formula of the GFFs in terms of twist-3 and twist-4 light-cone distribution amplitudes of nucleon. Power behaviors for these GFFs are obtained from the leading order calculations. Numeric results of the quark and gluon contributions to various GFFs are presented with model assumptions for the distribution amplitudes in the literature. We also present the perturbative calculations of the scalar form factor $\langle P$' $|F^2|P \rangle$ for pion and proton at large momentum transfer.

72 PHYSICS OF ELEMENTARY PARTICLES AND FIELDS↗
DOE OSTI2025

Effective field theory factorization for diffraction

We derive a factorization formula for coherent and incoherent ep diffraction using the soft collinear effective theory, utilizing multiple power expansion parameters to handle different kinematic regions. This goes beyond the known hard-collinear diffractive factorization to address the small-x Regge dynamics and Pomeron exchange from first principles. The effective field theory analysis also uncovers and factorizes an important irreducible incoherent background generated by color-nonsinglet exchange, dubbed “quasi-diffraction”, for which we calculate the associated Sudakov suppression. For unpolarized scattering we show that there are four diffractive structure functions at leading power, and point out the importance of studying ${F}_{3,4}^D$ through asymmetries, in addition to ${F}_{2,L}^D$. For the quasi-diffractive background, we make model independent predictions for ratios of the corresponding structure functions in a perturbative kinematic region. Our analysis also makes predictions for six leading-power spin-dependent structure functions. Finally, we provide connections to diffractive parton distributions, and assess the Ingelman-Schlein model. Our work lays a path for further QCD-based studies of diffraction.

72 PHYSICS OF ELEMENTARY PARTICLES AND FIELDS↗
DOE OSTI2022

Transverse Λ polarization in e + e – processes within a TMD factorization approach and the polarizing fragmentation function

We perform a re-analysis of Belle data for the transverse Λ and Λ¯ polarization in e + e – annihilation processes within a transverse momentum dependent (TMD) factorization approach. We consider two data sets, one referring to the associated production of Λ’s with a light unpolarized hadron in an almost back-to-back configuration, and one for the inclusive Λ production, with the reconstruction of the thrust axis. We adopt the Collins-Soper-Sterman framework and employ the recent formulation on the factorization of single-inclusive hadron production. This extends a previous phenomenological study carried out in a more simplified TMD approach, leading to a new extraction of the polarizing fragmentation function (FF). While confirming several features of the previous analysis, here we include the proper QCD scale dependence of this TMD FF and carefully exploit the role of its nonperturbative component. Here, the compatibility, within a unique TMD factorization scheme, of double and single-inclusive hadron production is discussed in detail. Moreover, we consider another data set for inclusive Λ production, at much larger energies, from the OPAL Collaboration, in order to test the consistency of the entire approach. Finally, we elaborate on some fundamental issues like the role of SU(2) isospin symmetry and the heavy quark contributions.

72 PHYSICS OF ELEMENTARY PARTICLES AND FIELDS↗
DOE OSTI2025

Enhancing Interpretability in Generative Modeling: Statistically Disentangled Latent Spaces Guided by Generative Factors in Scientific Datasets

This study addresses the challenge of statistically extracting generative factors from complex, high-dimensional datasets in unsupervised or semi-supervised settings. We investigate encoder-decoder-based generative models for nonlinear dimensionality reduction, focusing on disentangling low-dimensional latent variables corresponding to independent physical factors. Introducing Aux-VAE, a novel architecture within the classical Variational Autoencoder framework, we achieve disentanglement with minimal modifications to the standard VAE loss function by leveraging prior statistical knowledge through auxiliary variables. These variables guide the shaping of the latent space by aligning latent factors with learned auxiliary variables. We validate the efficacy of Aux-VAE through comparative assessments on multiple datasets, including astronomical simulations.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2025

Identification and overexpression of endogenous transcription factors to enhance lipid accumulation in the biotechnologically relevant species Chlamydomonas pacifica

Sustainable low-carbon energy solutions are critical to mitigating global carbon emissions. Algae-based platforms offer potential by converting carbon dioxide into valuable products while aiding carbon sequestration. However, scaling algae cultivation faces challenges like contamination in outdoor systems. Previously, our lab evolved Chlamydomonas pacifica, an extremophile green alga, which tolerates high temperature, pH, salinity, and light, making it ideal for large-scale bioproduct production, including biodiesel. Here, we enhanced lipid accumulation in evolved C. pacifica by identifying and overexpressing key endogenous transcription factors through genome-wide in-silico analysis and in-vivo testing. These factors include Lipid Remodeling Regulator 1 (CpaLRL1), Nitrogen Response Regulator 1 (CpaNRR1), Compromised Hydrolysis of Triacylglycerols 7 (CpaCHT7), and Phosphorus Starvation Response 1 (CpaPSR1). Under nitrogen deprivation, CpaLRL1, CpaNRR1, and CpaCHT7 overexpression enhanced lipid accumulation compared to wild-type. However, CpaPSR1 increased lipid accumulation compared to wild-type in normal media and did not increase further under nitrogen deprivation, highlighting the difference in function based on media conditions. Notably, lipid analysis of CpaPSR1 under normal media conditions revealed a 2.4-fold increase in triglycerides (TAGs) compared to the wild-type, highlighting its potential for biodiesel production. This approach provides a framework for transcription factor-focused metabolic engineering in algae, advancing bioenergy and biomaterial production.

Biofuels↗
DOE OSTI2021

Extension of the discrete generalized multigroup method using SPH factors

The discrete generalized multigroup (DGM) method provides a way to treat the energy dependence of neutron transport similarly to the standard multigroup approximation. However, DGM uses an orthogonal basis to retain the energy dependence in higher-order terms. Using correction factors similar to traditional Superhomogénéisation (SPH) factors, the DGM method may be extended to produce cross sections that are homogenized over both space and energy. Additionally, since some fine-group energy dependence is retained, the resulting homogenized cross sections are more problem-independent than cross sections homogenized by SPH factors alone. In particular, a 44-group set of cross sections is collapsed to approximately a 1% error in the pincell fission densities for a test problem using three DOF per coarse energy group.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2014

Dirac equation in low dimensions: The factorization method

We present a general approach to solve the (1+1) and (2+1)-dimensional Dirac equations in the presence of static scalar, pseudoscalar and gauge potentials, for the case in which the potentials have the same functional form and thus the factorization method can be applied. We show that the presence of electric potentials in the Dirac equation leads to two Klein–Gordon equations including an energy-dependent potential. We then generalize the factorization method for the case of energy-dependent Hamiltonians. Additionally, the shape invariance is generalized for a specific class of energy-dependent Hamiltonians. We also present a condition for the absence of the Klein paradox (stability of the Dirac sea), showing how Dirac particles in low dimensions can be confined for a wide family of potentials. - Highlights: • The low-dimensional Dirac equation in the presence of static potentials is solved. • The factorization method is generalized for energy-dependent Hamiltonians. • The shape invariance is generalized for energy-dependent Hamiltonians. • The stability of the Dirac sea is related to the existence of supersymmetric partner Hamiltonians.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2013

Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana

Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2014

Fibroblast growth factor receptor 4 promotes progression and correlates to poor prognosis in cholangiocarcinoma

Highlights: • FGFR4 is significantly related with N stage in IHCC, with T stage and TNM stage in PHCC. • FGFR4 is an independent prognostic factor in IHCC and PHCC. • FGFR4 promotes proliferation, invasion and EMT in cholangiocarinoma cell lines. • Inhibitor AP24354 can decrease proliferation, invasion and induce apoptosis of CCA. - Abstract: Fibroblast growth factor receptor 4 (FGFR4) is related to poor prognosis of several cancers, but the correlation between FGFR4 expression and cholangiocarcinoma (CCA) has not been well elucidated. We investigated the expression of FGFR4 in 83 intrahepatic cholangiocarcinomas (IHCCs), 75 perihilar cholangiocarcinomas (PHCCs) and 41 distal cholangiocarcinomas (DCCs) by immunohistochemistry (IHC), and subsequently evaluated association of FGFR4 with clinicopathologic parameters and survival rate. The rate of FGFR4 higher expression was 61.4% (51/83) in IHCCs, 53.3% (40/75) in PHCCs and 56.1% (23/41) in DCCs. FGFR4 expression was significantly related to poor prognosis of IHCC (P = 0.002) and PHCC (P = 0.019) with univariate analysis, and also identified as an independent prognostic factor in IHCC (P = 0.045) and PHCC (P = 0.049) with multivariate analysis. Additionally, with functional assays in vitro, we found FGFR4 can induce proliferation, invasion and epithelial–mesenchymal transition (EMT) of CCA cell lines with FGF19 stimulation. Moreover, FGFR4 inhibitor AP24354 can suppress proliferation, invasion and induce apoptosis of CCA cells. In conclusion, FGFR4 expression can be identified as a significant independent prognostic biomarker of IHCC and PHCC. FGFR4 played a pivotal role in proliferation, invasion and EMT of CCA. FGFR4 inhibitor can suppress proliferation, invasion and induce apoptosis of CCA, indicating that FGFR4 may act as a potential therapeutic target.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2014

Tumor associated osteoclast-like giant cells promote tumor growth and lymphangiogenesis by secreting vascular endothelial growth factor-C

Highlights: • M-CSF and RANKL expressing HeLa cells induced osteoclastogenesis in vitro. • We established OGC-containing tumor model in vivo. • OGC-containing tumor became larger independent of M-CSF or RANKL effect. • VEGF-C secreted from OGCs was a one of candidates for OGC-containing tumor growth. - Abstract: Tumors with osteoclast-like giant cells (OGCs) have been reported in a variety of organs and exert an invasive and prometastatic phenotype, but the functional role of OGCs in the tumor environment has not been fully clarified. We established tumors containing OGCs to clarify the role of OGCs in tumor phenotype. A mixture of HeLa cells expressing macrophage colony-stimulating factor (M-CSF, HeLa-M) and receptor activator of nuclear factor-κB ligand (RANKL, HeLa-R) effectively supported the differentiation of osteoclast-like cells from bone marrow macrophages in vitro. Moreover, a xenograft study showed OGC formation in a tumor composed of HeLa-M and HeLa-R. Surprisingly, the tumors containing OGCs were significantly larger than the tumors without OGCs, although the growth rates were not different in vitro. Histological analysis showed that lymphangiogenesis and macrophage infiltration in the tumor containing OGCs, but not in other tumors were accelerated. According to quantitative PCR analysis, vascular endothelial growth factor (VEGF)-C mRNA expression increased with differentiation of osteoclast-like cells. To investigate whether VEGF-C expression is responsible for tumor growth and macrophage infiltration, HeLa cells overexpressing VEGF-C (HeLa-VC) were established and transplanted into mice. Tumors composed of HeLa-VC mimicked the phenotype of the tumors containing OGCs. Furthermore, the vascular permeability of tumor microvessels also increased in tumors containing OGCs and to some extent in VEGF-C-expressing tumors. These results suggest that macrophage infiltration and vascular permeability are possible mediators in these tumors. These findings revealed that OGCs in the tumor environment promoted tumor growth and lymphangiogenesis, at least in part, by secreting VEGF-C.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2014

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2014

Role of pigment epithelium-derived factor in the involution of hemangioma: Autocrine growth inhibition of hemangioma-derived endothelial cells

Highlights: • PEDF was expressed and induced during the involuting phase of IH. • PEDF inhibited the cell growth of the involuting HemECs in an autocrine manner. • PEDF suppression restored the impaired cell growth of the involuting HemECs. - Abstract: Hemangioma is a benign tumor derived from abnormal blood vessel growth. Unlike other vascular tumor counterparts, a hemangioma is known to proliferate during its early stage but it is followed by a stage of involution where regression of the tumor occurs. The critical onset leading to the involution of hemangioma is currently not well understood. This study focused on the molecular identities of the involution of hemangioma. We demonstrated that a soluble factor released from the involuting phase of hemangioma-derived endothelial cells (HemECs) and identified pigment epithelium-derived factor (PEDF) as an anti-angiogenic factor that was associated with the growth inhibition of the involuting HemECs. The growth inhibition of the involuting HemECs was reversed by suppression of PEDF in the involuting HemECs. Furthermore, we found that PEDF was more up-regulated in the involuting phase of hemangioma tissues than in the proliferating or the involuted. Taken together, we propose that PEDF accelerates the involution of hemangioma by growth inhibition of HemECs in an autocrine manner. The regulatory mechanism of PEDF expression could be a potential therapeutic target to treat hemangiomas.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2015

Autoantibodies in dilated cardiomyopathy induce vascular endothelial growth factor expression in cardiomyocytes

Background: Autoantibodies have been identified as major predisposing factors for dilated cardiomyopathy (DCM). Patients with DCM show elevated serum levels of vascular endothelial growth factor (VEGF) whose source is unknown. Besides its well-investigated effects on angiogenesis, evidence is present that VEGF signaling is additionally involved in fibroblast proliferation and cardiomyocyte hypertrophy, hence in cardiac remodeling. Whether autoimmune effects in DCM impact cardiac VEGF signaling needs to be elucidated. Methods: Five DCM patients were treated by the immunoadsorption (IA) therapy on five consecutive days. The eluents from the IA columns were collected and prepared for cell culture. Cardiomyocytes from neonatal rats (NRCM) were incubated with increasing DCM-immunoglobulin-G (IgG) concentrations for 48 h. Polyclonal IgG (Venimmun N), which was used to restore IgG plasma levels in DCM patients after the IA therapy was additionally used for control cell culture purposes. Results: Elevated serum levels of VEGF decreased significantly after IA (Serum VEGF (ng/ml); DCM pre-IA: 45 ± 9.1 vs. DCM post–IA: 29 ± 6.7; P < 0.05). In cell culture, pretreatment of NRCM by DCM-IgG induced VEGF expression in a time and dose dependent manner. Biologically active VEGF that was secreted by NRCM significantly increased BNP mRNA levels in control cardiomyocytes and induced cell-proliferation of cultured cardiac fibroblast (Fibroblast proliferation; NRCM medium/HC-IgG: 1 ± 0.0 vs. NRCM medium/DCM-IgG 100 ng/ml: 5.6 ± 0.9; P < 0.05). Conclusion: The present study extends the knowledge about the possible link between autoimmune signaling in DCM and VEGF induction. Whether this observation plays a considerable role in cardiac remodeling during DCM development needs to be further elucidated. - Highlights: • Mechanisms of remodeling in dilated cardiomyopathy (DCM) are not fully understood. • Autoantibodies have been identified as major predisposing factors for DCM. • DCM patients show high serum levels of VEGF. • Recent data indicate that VEGF is involved in cardiac remodeling processes. • Whether autoimmune processes in DCM are involved in VEGF signaling are unclear.

60 APPLIED LIFE SCIENCES↗