Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “FORMING”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 667 records · Page 37
All sourcesNASA NTRSDOE OSTI
DOE OSTI2016

Apatite Based Ceramic Waste Forms for Immobilization of Radioactive Iodine, An Overview - 16155

Apatite based ceramic waste forms are the most promising candidates for immobilization of radioactive iodine (I-129). While lead-vanadium based apatites have been studied for a long time, significant progress has been made in recent years in the domain of calcium-phosphate based apatites for iodine immobilization. This article is an attempt to present an overview of the progress that has been made in terms of developing novel synthesis and processing routes to contain iodine in apatite based ceramic waste forms. The challenges associated with current state-of-the art waste form synthesis techniques along with novel routes to synthesize these waste forms at low temperatures have also been discussed. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2016

Secondary Waste Form Development and Data Package for Hanford's Integrated Disposal Facility Performance Assessment - 16479

The Hanford Low-Activity Waste (LAW) Vitrification facility is planned to immobilize Hanford tank waste for on-site, near-surface disposal at Hanford's Integrated Disposal Facility (IDF). During this process, liquid and solid secondary wastes will be generated which are also slated for disposal at the IDF. In order to receive authorization to dispose of the waste in the IDF, a Performance Assessment (PA) must be completed in accordance with DOE Order 435.1, Radioactive Waste Management, and its accompanying Manual. The PA must include calculations of potential doses to a member of the public for a 1,000-year period to provide a reasonable expectation that performance objectives will not be exceeded and that the waste will be managed in a manner that is protective of worker and public health and safety, and the environment. Liquid and solid secondary wastes are planned to be immobilized within cementitious waste forms similar to those used elsewhere in the United States and around the world for permanent disposal of low-level radioactive waste (LLW). Data packages and supporting documents are being developed to provide the technical underpinning for the analyses of contaminant releases to the environment from these waste forms for the IDF PA. Traditionally, releases from cementitious waste forms have utilized a diffusion-limited release model using contaminant-specific diffusivities measured in standard leach tests as inputs. More mechanistic modeling techniques are under development to increase the rigor of the PA analyses. In addition, recent testing has shown diffusivities of key contaminants can be reduced by several orders-of-magnitude through optimized formulation of the waste form and use of additives to bind specific contaminants. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2018

The Effect of Environmental Relative Humidity on Carbonation and Oxidation in a Cementitious Waste Form - 18448

Cementitious material has been developed and used for the nuclear waste disposal. Cast Stone, a type of cementitious waste form, is considered for solidification and immobilization of part of low activity radioactive waste (LAW) at DOE Hanford Site in Richland, WA. During its life cycle, the waste form, which is produced from Portland cement, fly ash, blast furnace slag and liquid waste, is subject to reaction with carbon dioxide and oxygen, both in gaseous and dissolved form. The reactions may alter the physical and chemical properties of the waste form and thus change its retention ability for the radionuclides. Therefore, understanding the rate and the impact of oxidation and carbonation in the material is important for projecting the long-term performance of Cast Stone. However, the rate of carbonation and oxidation in Cast Stone closely depends on the moisture content in the material, which varies largely with the environmental relative humidity (RH). In this study, experiments are carried out to study the effect of environmental relative humidity on the carbonation and oxidation rate as well as the leaching of the constituents from Cast Stone. Cast Stone samples doped with Cr as a reaction indicator are aged for 16 to 32 weeks under N{sub 2}, air, and 2% CO{sub 2} (in nitrogen) environments with various relative humidities (15%, 40%, 68%, 100%). After aging, samples were tested for the pH-dependent leaching (EPA Method 1313) and mass transfer rate under diffusion-controlled leaching (EPA Method 1315) of constituents. The progress of the carbonation was measured for each condition to determine the rate of carbonation front ingress. The results show that environmental relative humidity strongly influences carbonation and oxidation in Cast Stone; however, the impact is different for the rate of reaction and for the extent of reactions. The former refers to the rate at which the reaction front ingresses, while the latter refers to the fraction of the material reacted. For both carbonation and oxidation, the largest impact of the reactions at the exposure surface is observed at intermediate relative humidity (68%). However, for carbonation, the reaction front evolves more rapidly under drier conditions, with the highest rate observed at 15% RH. As a result, carbonation and oxidation have different degree of impact on the leaching behavior of Cast Stone samples aged under various relative humidities. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2019

Solid Secondary Waste Immobilization in Cementitious Waste Forms at the Hanford Site - 19081

During operations of the Hanford Tank Waste Treatment and Immobilization Plant, solid secondary wastes (SSW) will be generated. These materials include HEPA filters, granular activated carbon (GAC), and silver mordenite (AgM). The planned disposal pathway for SSW is through solidification (blending) or encapsulation in a cementitious waste form and then disposal on site at the Hanford Site's Integrated Disposal Facility. Performance assessment evaluations of SSW forms have been performed; however, limited experimental data on simulated SSW is available as input. This paper will cover efforts to fill this gap in experimental data through testing of simulated SSW materials. Two grout formulations were used in the tests: 1) Hanford grout mix 5, a mix of 25 wt% ordinary Portland cement (OPC) and 75 wt% fly ash (FA); and 2) the Cast Stone dry blend of 47 wt% blast furnace slag, 45 wt% FA, and 8 wt% OPC. The sorption (Kd) of potential contaminants (iodide, iodate, technetium) to the grouts and SSW materials was investigated in simulated grout pore water. Waste forms containing GAC and AgM were prepared using the two grout formulations and characterized using scanning electron microscopy energy dispersive X-ray spectroscopy and X-ray diffraction. Acquiring this information will further support the candidacy of cementitious waste forms to be used for disposal of SSW at Hanford. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2017

Ion Exchange of LiCl-KCl in H-Y Zeolite for Dechlorination of Electro-refiner Salt Waste Forms

The present study focuses on the aim to significantly reduce the volume of electro-refiner waste salt (primarily LiCl-KCl) via dechlorination during waste form production. The target waste form will be zeolite loaded with metallic elements from the salt bound together by glass. Since the presence of I-129 and possibly Cl-36 will have a significant effect on long-term dose associated with the waste form, the ability to separate these halides and either recycle or dispose of them in special engineered waste forms is deemed attractive. A new method has been proposed to achieve this dechlorination involving the ion-exchange reaction between molten chloride ER salt and the protonated Y zeolite. Halides such as Cl and I should off-gas as HCl or HI, which can then be separated and decomposed into Cl{sub 2} and I{sub 2}, respectively. The Cl{sub 2} gas can either be captured and disposed of, or recycled to the electrometallurgical process. Initial experiments have been completed to determine the optimal zeolite drying temperature and to demonstrate ion exchange with non-optimized conditions. Further study in the future will strive to improve the kinetics of the ion-exchange reaction and to maximize the removal of the chlorine.

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2024

AI/ML-assisted Design of Phosphate Glass and Ceramic Nuclear Waste Forms

Borosilicate glass is the widely accepted waste form for immobilization of high and medium level nuclear wastes. Advances in nuclear energies and new reactor designs require the development of new waste forms. For example, wastes from molten salt reactors and reprocessing of nuclear fuels lead to salt-based wastes that are difficult to be immobilized by conventional borosilicate glasses due to limited solubility and waste loading. In designing new waste forms, machine learning (ML) and artificial intelligence (AI) based approaches are much needed and can be beneficial in enabling a more efficient design in large parameter spaces as compared to traditional Edisonian trial-and-error approaches. Here, we report in this paper the rationale and latest progress of our ML/AI-based design of phosphate-based waste forms.

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2024

Digital Light Process 3D Printing of Magnetically Aligned Liquid Crystalline Elastomer Free–forms

Liquid crystalline elastomers (LCEs) are anisotropic soft materials capable of large dimensional changes when subjected to a stimulus. The magnitude and directionality of the stimuli-induced thermomechanical response is associated with the alignment of the LCE. Recent reports detail the preparation of LCEs by additive manufacturing (AM) techniques, predominately using direct ink write printing. Another AM technique, digital light process (DLP) 3D printing, has generated significant interest as it affords LCE free-forms with high fidelity and resolution. However, one challenge of printing LCEs using vat polymerization methods such as DLP is enforcing alignment. Here, we document the preparation of aligned, main-chain LCEs via DLP 3D printing using a 100 mT magnetic field. Systematic examination isolates the contribution of magnetic field strength, alignment time, and build layer thickness on the degree of orientation in 3D printed LCEs. Informed by this fundamental understanding, DLP is used to print complex LCE free-forms with through-thickness variation in both spatial orientations. Further, the hierarchical variation in spatial orientation within LCE free-forms is used to produce objects that exhibit mechanical instabilities upon heating. DLP printing of aligned LCEs opens new opportunities to fabricate stimuli-responsive materials in form factors optimized for functional use in soft robotics and energy absorption.

36 MATERIALS SCIENCE↗
DOE OSTI2022

Form factors and spectral densities from Lightcone Conformal Truncation

We use the method of Lightcone Conformal Truncation (LCT) to obtain form factors and spectral densities of local operators $\mathcal{O}$ in $\phi^4$ theory in two dimensions. We show how to use the Hamiltonian eigenstates from LCT to obtain form factors that are matrix elements of a local operator $\mathcal{O}$ between single-particle bra and ket states, and we develop methods that significantly reduce errors resulting from the finite truncation of the Hilbert space. We extrapolate these form factors as a function of momentum to the regime where, by crossing symmetry, they are form factors of $\mathcal{O}$ between the vacuum and a two-particle asymptotic scattering state. We also compute the momentum-space time-ordered two-point functions of local operators in LCT. These converge quickly at momenta away from branch cuts, allowing us to indirectly obtain the time-ordered correlator and the spectral density at the branch cuts. We focus on the case where the local operator $\mathcal{O}$ is the trace Θ of the stress tensor.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2012

Comparison of Short-Term Oxidation Behavior of Model and Commercial Chromia-Forming Ferritic Stainless Steels in Air with Water Vapor

A high-purity Fe-20Cr and commercial type 430 ferritic stainless steel were exposed at 700 and 800 C in dry air and air with 10% water vapor (wet air) and characterized by SEM, XRD, STEM, SIMS, and EPMA. The Fe-20Cr alloy formed a fast growing Fe-rich oxide scale at 700 C in wet air after 24 h exposure, but formed a thin chromia scale at 700 C in dry air and at 800 C in both dry air and wet air. In contrast, thin spinel + chromia base scales with a discontinuous silica subscale were formed on 430 stainless steel under all conditions studied. Extensive void formation was observed at the alloy-oxide interface for the Fe-20Cr in both dry and wet conditions, but not for the 430 stainless steel. The Fe-20Cr alloy was found to exhibit a greater relative extent of subsurface Cr depletion than the 430 stainless steel, despite the former's higher Cr content. Depletion of Cr in the Fe-20Cr after 24 h exposure was also greater at 700 C than 800 C. The relative differences in oxidation behavior are discussed in terms of the coarse alloy grain size of the high-purity Fe-20Cr material, and the effects of Mn, Si, and C on the oxide scale formed on the 430 stainless steel.

08 HYDROGEN↗
DOE OSTI2012

Comparison of Different Upscaling Methods for Predicting Thermal Conductivity of Complex Heterogeneous Materials System: Application on Nuclear Waste Forms

To develop a strategy in thermal conductivity prediction of a complex heterogeneous materials system, loaded nuclear waste forms, the computational efficiency and accuracy of different upscaling methods have been evaluated. The effective thermal conductivity, obtained from microstructure information and local thermal conductivity of different components, is critical in predicting the life and performance of waste form during storage. Several methods, including the Taylor model, Sachs model, self-consistent model, and statistical upscaling method, were developed and implemented. Microstructure based finite element method (FEM) prediction results were used to as benchmark to determine the accuracy of the different upscaling methods. Micrographs from waste forms with varying waste loadings were used in the prediction of thermal conductivity in FEM and homogenization methods. Prediction results demonstrated that in term of efficiency, boundary models (e.g., Taylor model and Sachs model) are stronger than the self-consistent model, statistical upscaling method, and finite element method. However, when balancing computational efficiency and accuracy, statistical upscaling is a useful method in predicting effective thermal conductivity for nuclear waste forms.

36 MATERIALS SCIENCE↗
DOE OSTI2018

Constitutive Behavior and Forming Limit of Mg-Al-Ca-Gd Alloy Sheets at Room and Elevated Temperatures

The constitutive behavior and forming limit of a newly developed magnesium alloy sheet containing rare earth elements (Mg-Al-Ca-Gd) were investigated. Anisotropic constitutive constants were obtained through tensile tests at various temperatures and strain rates. A modified Grosman equation was adopted to describe the constitutive behavior of the magnesium alloy, taking into account the effects of temperature and strain rate. Results revealed that the proper forming temperature and the strain rate for the newly developed magnesium alloy were 210 °C and 0.001 s{sup −1}, respectively. Forming limit curves at room temperature and 210 °C were, respectively, established by the combination of hemispherical punch tests and theoretical predictions using a modified Marciniak–Kuczynski model. The accuracy of the theoretical prediction of FLD was discussed. The forming limit of Mg-Al-Ca-Gd alloy sheet increased when heated from room temperature to 210 °C.

36 MATERIALS SCIENCE↗
DOE OSTI2019

Effect of Preheated Microstructure Vis-à-vis Process Parameters and Characterization of Orange Peel in Incremental Forming of AA1050 Sheets

The present investigation systematically analyzes and compares the influence of microstructure and crystallographic texture of AA1050 sheet to that of the most critical process parameters, namely tool dimension, and incremental step depth, in single-point incremental forming (SPIF) process. The sheet samples were preheated at different temperatures to reform the original, i.e., distorted and misoriented grain distribution. The results from experimental and statistical analyses report higher sensitivity of global spring back, surface topography and forming limits strains to variations in microstructure and texture than tool diameter and incremental step depth. The preheating of the sheets resulted in the formation of preferential texture by grain reformation, which leads to the increase in the fraction of homogeneous orientated grains. Such grains increase the maximum forming limit strains and reduce the global spring back in SPIF. Fractography analysis of the failed components revealed that improvement in formability due to grain homogenization (developed texture) may be attributed to larger average void diameter. Empirical models were also developed, and optimized levels of parameters were identified to maximize the efficiency of the SPIF process. Further, qualitative and quantitative characterization of orange peel roughness was carried out by segregating the external formed surface into surfaces subjected to orange peel roughness and tool-induced texture.

36 MATERIALS SCIENCE↗
DOE OSTI2021

Review: Magnesium Sheet Alloy Development for Room Temperature Forming

Sheet metal forming operations in the automotive industry, including stamping, flanging, bending, hemming and trimming, are dominantly done at room temperature (RT). Unfortunately, the poor RT formability of magnesium due to its hexagonal close packed (HCP) structure and generally strong texture has limited the use of these processes in high-volume automotive production. However, the formability of magnesium can be improved via fine grain structure and random texture to enable some RT forming operations. Here, this paper presents the latest magnesium alloy development and evaluation by the United States Automotive Materials Partnership (USAMP) in collaboration with its university partners. A new sheet alloy developed in a recent USAMP project, ZAXME11100 (USAMP Alloy 2 Plus), offers excellent ductility (31% tensile elongation) and RT formability (7.8 mm Erichsen Index) in solution-treated condition (T4), and a high yield strength (270 MPa) upon post-forming aging treatment (T6), promising RT forming for automotive applications.

36 MATERIALS SCIENCE↗
DOE OSTI2022

Cs 3 Bi 2 I 9 -hydroxyapatite composite waste forms for cesium and iodine immobilization

Perovskite-based ceramic composites were developed as potential waste form materials for immobilizing cesium (Cs) and iodine (I) with high waste loadings and chemical durability. The perovskite Cs 3 Bi 2 I 9 has high Cs (22 wt%) and I (58 wt%) content, and thus can be used as a potential host phase to immobilize these critical radionuclides. In this work, the perovskite Cs 3 Bi 2 I 9 phase was synthesized by a cost effective solution-based approach, and was embedded into a highly durable hydroxyapatite matrix by spark plasma sintering to form dense ceramic composite waste forms. The chemical durabilities of the monolithic Cs 3 Bi 2 I 9 and Cs 3 Bi 2 I 9 -hydroxyapatite composite pellets were investigated by static and semi-dynamic leaching tests, respectively. Cs and I are incongruently released from the matrix for both pure Cs 3 Bi 2 I 9 and composite structures. The normalized Cs release rate is faster than that of I, which can be explained by the difference in the strengths between Cs-I and Bi-I bonds as well as the formation of insoluble micrometer-sized BiOI precipitates. The activation energies of elemental releases based on dissolution and diffusion-controlled mechanisms are determined with significantly higher energy barriers for dissolution from the composite versus that of the monolithic Cs 3 Bi 2 I 9 . The ceramic-based composite waste forms exhibit excellent chemical durabilities and waste loadings, commensurate with the state-of-the-art glass-bonded perovskite composites for I and Cs immobilization.

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2014

Fractional corresponding operator in quantum mechanics and applications: A uniform fractional Schrödinger equation in form and fractional quantization methods

In this paper we use Dirac function to construct a fractional operator called fractional corresponding operator, which is the general form of momentum corresponding operator. Then we give a judging theorem for this operator and with this judging theorem we prove that R–L, G–L, Caputo, Riesz fractional derivative operator and fractional derivative operator based on generalized functions, which are the most popular ones, coincide with the fractional corresponding operator. As a typical application, we use the fractional corresponding operator to construct a new fractional quantization scheme and then derive a uniform fractional Schrödinger equation in form. Additionally, we find that the five forms of fractional Schrödinger equation belong to the particular cases. As another main result of this paper, we use fractional corresponding operator to generalize fractional quantization scheme by using Lévy path integral and use it to derive the corresponding general form of fractional Schrödinger equation, which consequently proves that these two quantization schemes are equivalent. Meanwhile, relations between the theory in fractional quantum mechanics and that in classic quantum mechanics are also discussed. As a physical example, we consider a particle in an infinite potential well. We give its wave functions and energy spectrums in two ways and find that both results are the same.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2016

Microscopic relaxations in a protein sustained down to 160 K in a non-glass forming organic solvent

In this paper, we have studied microscopic dynamics of a protein in carbon disulfide, a non-glass forming solvent, down to its freezing temperature of ca. 160 K. We have utilized quasielastic neutron scattering. A comparison of lysozyme hydrated with water and dissolved in carbon disulfide reveals a stark difference in the temperature dependence of the protein's microscopic relaxation dynamics induced by the solvent. In the case of hydration water, the common protein glass-forming solvent, the protein relaxation slows down in response to a large increase in the water viscosity on cooling down, exhibiting a well-known protein dynamical transition. The dynamical transition disappears in non-glass forming carbon disulfide, whose viscosity remains a weak function of temperature all the way down to freezing at just below 160 K. The microscopic relaxation dynamics of lysozyme dissolved in carbon disulfide is sustained down to the freezing temperature of its solvent at a rate similar to that measured at ambient temperature. Finally, our results demonstrate that protein dynamical transition is not merely solvent-assisted, but rather solvent-induced, or, more precisely, is a reflection of the temperature dependence of the solvent's glass-forming dynamics.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2014

A functional fragment of Tau forms fibers without the need for an intermolecular cysteine bridge

Highlights: • A functional fragment of Tau forms bundled ribbon-like fibrils. • Nucleation of its fibril formation is faster than for full-length Tau. • In contrast to full-length Tau, without cysteines, the fragment still forms fibers. - Abstract: We study the aggregation of a fragment of the neuronal protein Tau that contains part of the proline rich domain and of the microtubule binding repeats. When incubated at 37 °C with heparin, the fragment readily forms fibers as witnessed by Thioflavin T fluorescence. Electron microscopy and NMR spectroscopy show bundled ribbon like structures with most residues rigidly incorporated in the fibril. Without its cysteines, this fragment still forms fibers of a similar morphology, but with lesser Thioflavin T binding sites and more mobility for the C-terminal residues.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2014

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

60 APPLIED LIFE SCIENCES↗