Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “STRESSES”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 559 records · Page 31
All sourcesNASA NTRSDOE OSTI
DOE OSTI2024

Molecular mechanisms and environmental adaptations of flagellar loss and biofilm growth of Rhodanobacter under environmental stress

Biofilms aid bacterial adhesion to surfaces via direct and indirect mechanisms, and formation of biofilms is considered as an important strategy for adaptation and survival in suboptimal environmental conditions. However, the molecular underpinnings of biofilm formation in subsurface sediment/groundwater ecosystems where microorganisms often experience fluctuations in nutrient input, pH, and nitrate or metal concentrations are underexplored. Here, we examined biofilm formation under different nutrient, pH, metal, and nitrate regimens of 16 Rhodanobacter strains isolated from subsurface groundwater wells spanning diverse levels of pH (3.5 to 5) and nitrates (13.7 to 146 mM). Eight Rhodanobacter strains demonstrated significant biofilm growth under low pH, suggesting adaptations for survival and growth at low pH. Biofilms were intensified under aluminum stress, particularly in strains possessing fewer genetic traits associated with biofilm formation, findings warranting further investigation. Through random barcode transposon-site sequencing (RB-TnSeq), proteomics, use of specific mutants, and transmission electron microscopy analysis, we discovered flagellar loss under aluminum stress, indicating a potential relationship between motility, metal tolerance, and biofilm growth. Comparative genomic analyses revealed the absence of flagella and chemotaxis genes and the presence of a putative type VI secretion system in the highly biofilm-forming strain FW021-MT20. In this study we identified genetic determinants associated with biofilm growth under metal stress in a predominant environmental genus, Rhodanobacter, and identified traits aiding survival and adaptation to contaminated subsurface environments.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Role of point defects in stress-induced martensite transformations in NiTi shape memory alloys: A molecular dynamics study

Shape-memory properties of equiatomic NiTi rely on the thermal- or stress-induced reversible martensitic phase transformation between the $\textit{B}$2 and $\textit{B}$19' phases. Irradiation defects suppress thermal-induced transformations, but their effects on stress-induced transformations are poorly understood. In this work, we use molecular dynamics to investigate the effect of vacancies, vacancy clusters, interstitials, and antisite defects on stress-induced transformations. All defects suppress the transformation, but vacancy clusters do so to the greatest extent, while antisite defects do so to the least extent. The responsible mechanisms are grain boundary pinning and chemical disordering.

36 MATERIALS SCIENCE↗
DOE OSTI2020

Shear Softening in a Metallic Glass: First-Principles Local-Stress Analysis

Metallic glasses deform elastically under stress. However, the atomic-level origin of elastic properties of metallic glasses remain unclear. In this Letter using ab initio molecular dynamics simulations of the Cu 5 0Zr 50 metallic glass under shear strain, we show that the heterogeneous stress relaxation results in the increased charge transfer from Zr to Cu atoms, enhancing the softening of the shear modulus. Changes in compositional short-range order and atomic position shifts due to the nonaffine deformation are discussed. It is shown that the Zr subsystem exhibits a stiff behavior, whereas the displacements of Cu atoms from their initial positions, induced by the strain, provide the stress drop and softening.

36 MATERIALS SCIENCE↗
DOE OSTI2024

Spot pattern welding scanning strategy for sensor embedding and residual stress reduction in laser-foil-printing additive manufacturing

Here, this paper aims to present spot pattern welding (SPW) as a scanning strategy for laser-foil-printing (LFP) additive manufacturing (AM) in place of the previously used continuous pattern welding (CPW) (line-raster scanning). The SPW strategy involves generating a sequence of overlapping spot welds on the metal foil, allowing the laser to form dense and uniform weld beads. This in turn reduces thermal gradients, promotes material consolidation and helps mitigate process-related risks such as thermal cracking, porosity, keyholing and Marangoni effects. 304L stainless steel (SS) feedstock is used to fabricate test specimens using the LFP system. Imaging techniques are used to examine the melt pool dimensions and layer bonding. In addition, the parts are evaluated for residual stresses, mechanical strength and grain size. Compared to CPW, SPW provides a more reliable heating/cooling relationship that is less dependent on part geometry. The overlapping spot welds distribute heat more evenly, minimizing the risk of elevated temperatures during the AM process. In addition, the resulting dense and uniform weld beads contribute to lower residual stresses in the printed part. To the best of the authors’ knowledge, this is the first study to thoroughly investigate SPW as a scanning strategy using the LFP process. In general, SPW presents a promising strategy for securing embedded sensors into LFP parts while minimizing residual stresses.

36 MATERIALS SCIENCE↗
DOE OSTI2020

On the nonlinear temperature dependence of residual stresses in solid oxide fuel cells

The residual stresses in a dense yttria-stabilized zirconia (YSZ) layer bonded to a porous NiO-YSZ substrate were measured by X-ray diffraction in air between 25°C and 900°C. In this work, it was found that the residual stresses on the outer surface of the YSZ layer were compressive, that their magnitude increased with decreasing temperature, and that the temperature dependence was nonlinear particularly at temperatures below 600°C. An elastic model that incorporates micromechanics and laminate theory was formulated to successfully predicts the nonlinearity of the temperature dependence of the residual stresses by accounting for the effect of the order-disorder transition experienced by YSZ around 600°C and the magnetic transition of NiO at the Néel temperature around 265°C, on the properties of these materials. The implications of the results for the reliability of solid oxide fuel cells are discussed.

25 ENERGY STORAGE↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

F‐Box Protein‐Mediated Proteolytic Regulation of Phenylpropanoid Metabolism in Response to Biotic and Abiotic Stresses

Protein ubiquitination is a central regulatory mechanism governing plant growth, development and environmental adaptation. Ubiquitylomic studies have revealed that many enzymes in phenylpropanoid biosynthetic pathways are subject to ubiquitination. Increasing evidence indicates that specific F-box proteins target key enzymes in these pathways, including PAL, CCR, CAD, COMT and peroxidases in the lignin biosynthetic branch, and CHS in the flavonoid biosynthetic branch, thereby promoting their ubiquitination and selective degradation. These F-box proteins act in response to diverse developmental and environmental cues, including cellular carbon status, light quality and intensity, and biotic stresses (e.g., pathogen and insect attack). By regulating the stability and activity of both enzymes and regulatory proteins involved in phenylpropanoid biosynthesis, F-box proteins modulate the accumulation of simple phenolics and lignin polymers, ultimately contributing to plant resilience. This review summarizes recent advances in the characterization of F-box proteins involved in phenylpropanoid metabolism and their regulatory roles in response to biotic and abiotic stresses and identifies key knowledge gaps that limit mechanistic understanding of F-box protein-mediated proteolytic regulation of phenylpropanoid metabolism. In conclusion, insights into ubiquitin-mediated proteolytic control of phenylpropanoid metabolism offer promising avenues for enhancing bioactive phenolic production, advancing biofuel feedstock engineering and improving crop stress tolerance.

(A)biotic stress↗
DOE OSTI2026

Single-cell proteomics of Arabidopsis leaf mesophyll reveals dynamic protein responses to water-deficit stress

Background The application of single-cell omics tools to biological systems can provide unique insights into diverse cellular populations and their heterogeneous responses to internal and external perturbations. Thus far, most single-cell studies in plant systems have been limited to RNA-sequencing approaches, which only provide indirect readouts of cellular functions. Results Here, we present a single-cell proteomics workflow for plant cells that integrates tape-sandwich protoplasting, piezoelectric cell sorting, nanoPOTS sample preparation, and ion mobility-based MS data acquisition method for label-free single-cell proteomics analysis of Arabidopsis leaf mesophyll cells. From a single leaf protoplast, over 3,000 proteins were quantified with high precision. The workflow is demonstrated to identify stress associated changes in protein abundance by analyzing 117 protoplasts from well-watered and water-deficit stressed plants. Additionally, we describe a new approach for constructing covarying protein networks at the single-cell level and demonstrate how single-cell protein covariation analysis can reveal previously unrecognized protein functions while also capturing stress-induced changes in protein–protein dynamics. Conclusions The label-free scProteomic approach presented here represents a significant advance through the demonstration of a facile protoplast isolation method combined with deep and precise proteomic coverage of Arabidopsis leaf mesophyll cell types. We believe this study will serve as an informative reference to future plant scProteomic investigations.

Arabidopsis↗
DOE OSTI2021

Processed Lab Data for Neural Network-Based Shear Stress Level Prediction

Machine learning can be used to predict fault properties such as shear stress, friction, and time to failure using continuous records of fault zone acoustic emissions. The files are extracted features and labels from lab data (experiment p4679). The features are extracted with a non-overlapping window from the original acoustic data. The first column is the time of the window. The second and third columns are the mean and the variance of the acoustic data in this window, respectively. The 4th-11th column is the the power spectrum density ranging from low to high frequency. And the last column is the corresponding label (shear stress level). The name of the file means which driving velocity the sequence is generated from. Data were generated from laboratory friction experiments conducted with a biaxial shear apparatus. Experiments were conducted in the double direct shear configuration in which two fault zones are sheared between three rigid forcing blocks. Our samples consisted of two 5-mm-thick layers of simulated fault gouge with a nominal contact area of 10 by 10 cm^2. Gouge material consisted of soda-lime glass beads with initial particle size between 105 and 149 micrometers. Prior to shearing, we impose a constant fault normal stress of 2 MPa using a servo-controlled load-feedback mechanism and allow the sample to compact. Once the sample has reached a constant layer thickness, the central block is driven down at constant rate of 10 micrometers per second. In tandem, we collect an AE signal continuously at 4 MHz from a piezoceramic sensor embedded in a steel forcing block about 22 mm from the gouge layer The data from this experiment can be used with the deep learning algorithm to train it for future fault property prediction.

15 GEOTHERMAL ENERGY↗
DOE OSTI2025

Multiplexing Focusing Analyzer for Efficient Stress-Strain Measurements

Statement of the problem or situation that is being addressed. Although thermal and cold neutron scattering is widely used and is critical for success in many areas of materials science and engineering, relatively low neutron fluxes severely limit applications of not only laboratory neutrons generators, but also large national neutron facilities. State-of-the-art thermal and cold neutron sources are large expensive national facilities, which serve diverse community of scientific and industrial users. The constant need to improve the instruments performance, stems from the fact that neutron methods are gaining in popularity, and becoming more and more powerful, while new neutron sources are not being constructed to keep pace with the developments and needs of the scientific community. Small research reactors at universities and National Labs, and laboratory-based neutron generators, are necessary not only for education and training, but also when samples cannot be transported to other facilities. However, the standard neutron techniques, which were developed for high-flux facilities, require much higher efficiencies to be used effectively with the low fluxes of small sources. Thus, the efficient use of neutron sources, such as with our proposed analyzer, is important for the progress and broader use of these neutron techniques. General statement of how this problem is being addressed. We propose to design and demonstrate novel diffractive optical device, which will enable very efficient residual stress neutron diffractometers. The proposed device will be a multi-foil analyzer, where each foil is constructed of focusing bent single crystals of Si. Such device will enable polychromatic residual stress neutron diffraction. At large national facilities, such as at Oak Ridge National Laboratory, these analyzers would enable very fast measurements for determining residual stress tensors, raster large samples or screen multiple samples. Commercial Applications and Other Benefits The outcome of this project would be the demonstration of commercial devices, novel neutron optical components, which could be utilized to improve the performance of existing instruments or build novel neutron scattering instruments at DOE neutron facilities and commercial laboratory neutron sources. These new devices will widen the scope of research conducted using neutrons and enable measurements not feasible at present. Summary for Members of Congress Thermal and cold neutron beams are a powerful materials science probe, which provide unique information about the structure of matter. The proposed innovations expand the reach of neutron-based investigations to new materials and industries by enabling new instrumentation capabilities, thereby greatly enhancing and expanding the role of small, laboratory-based neutron instrumentation, and improving education and training of neutron users.

46 INSTRUMENTATION RELATED TO NUCLEAR SCIENCE AND ↗
DOE OSTI2024

Uniaxial stress effect on the electronic structure of quantum materials

Uniaxial stress has proven to be a powerful experimental tuning parameter for effectively controlling lattice, charge, orbital, and spin degrees of freedom in quantum materials. In addition, its ability to manipulate the symmetry of materials has garnered significant attention. Recent technical progress to combine uniaxial stress cells with quantum oscillation and angle-resolved photoemission techniques allowed to study the electronic structure as function of uniaxial stress. This review provides an overview on experimental advancements in methods and examines studies on diverse quantum materials, encompassing the semimetal WTe 2 , the unconventional superconductor Sr 2 RuO 4 , Fe-based superconductors, and topological materials.

36 MATERIALS SCIENCE↗
DOE OSTI2021

Recent Advances in the Roles of HSFs and HSPs in Heat Stress Response in Woody Plants

A continuous increase in ambient temperature caused by global warming has been considered a worldwide threat. As sessile organisms, plants have evolved sophisticated heat shock response (HSR) to respond to elevated temperatures and other abiotic stresses, thereby minimizing damage and ensuring the protection of cellular homeostasis. In particular, for perennial trees, HSR is crucial for their long life cycle and development. HSR is a cell stress response that increases the number of chaperones including heat shock proteins (HSPs) to counter the negative effects on proteins caused by heat and other stresses. There are a large number of HSPs in plants, and their expression is directly regulated by a series of heat shock transcription factors (HSFs). Therefore, understanding the detailed molecular mechanisms of woody plants in response to extreme temperature is critical for exploring how woody species will be affected by climate changes. In this review article, we summarize the latest findings of the role of HSFs and HSPs in the HSR of woody species and discuss their regulatory networks and cross talk in HSR. In addition, strategies and programs for future research studies on the functions of HSFs and HSPs in the HSR of woody species are also proposed.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Phloem Exudate Protein Profiles during Drought and Recovery Reveal Abiotic Stress Responses in Tomato Vasculature

Drought is the leading cause of agricultural yield loss among all abiotic stresses, and the link between water deficit and phloem protein contents is relatively unexplored. Here we collected phloem exudates from Solanum lycopersicum leaves during periods of drought stress and recovery. Our analysis identified 2558 proteins, the most abundant of which were previously localized to the phloem. Independent of drought, enrichment analysis of the total phloem exudate protein profiles from all samples suggests that the protein content of phloem sap is complex, and includes proteins that function in chaperone systems, branched-chain amino acid synthesis, trehalose metabolism, and RNA silencing. We observed 169 proteins whose abundance changed significantly within the phloem sap, either during drought or recovery. Proteins that became significantly more abundant during drought include members of lipid metabolism, chaperone-mediated protein folding, carboxylic acid metabolism, abscisic acid signaling, cytokinin biosynthesis, and amino acid metabolism. Conversely, proteins involved in lipid signaling, sphingolipid metabolism, cell wall organization, carbohydrate metabolism, and a mitogen-activated protein kinase are decreased during drought. Our experiment has achieved an in-depth profiling of phloem sap protein contents during drought stress and recovery that supports previous findings and provides new evidence that multiple biological processes are involved in drought adaptation.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Acute Ozone-Induced Transcriptional Changes in Markers of Oxidative Stress and Glucocorticoid Signaling in the Rat Hippocampus and Hypothalamus Are Sex-Specific

Exposure to a prototypic air pollutant ozone (O 3 ) has been associated with the activation of neuroendocrine stress response along with neural changes in oxidative stress (OS), inflammation, and Alzheimer’s disease-like pathologies in susceptible animal models. We hypothesized that neural oxidative and transcriptional changes induced by O 3 in stress responsive regions are sex-dependent. Male and female adult Long–Evans rats were exposed to filtered air or O 3 for two consecutive days (0.8 ppm, 4 h/day) and brain regions were flash-frozen. Activities of cerebellar OS parameters and mitochondrial complex I, II, and IV enzymes were assessed to confirm prior findings. We assessed transcriptional changes in hypothalamus (HYP) and hippocampus (HIP) for markers of OS, microglial activity and glucocorticoid signaling using qPCR. Although there were no O 3 or sex-related differences in the cerebellar activities of OS and mitochondrial enzymes, the levels of protein carbonyls and complex II activities were higher in females regardless of O 3 . There were no statistical differences in baseline expression of genes related to OS (Cat, Dhcr24, Foxm1, Gpx1, Gss, Nfe2l2, Sod1) except for lower HYP Sod1 expression in air-exposed females than males, and higher HIP Gss expression in O 3 -exposed females relative to matched males. Microglial marker Aif1 expression was higher in O 3 -exposed females relative to males; O 3 inhibited Itgam only in males. The expression of Bdnf in HIP and HYP was inhibited by O 3 in both sexes. Genes related to glucocorticoid signaling (Fkbp4, Fkbp5, Hsp90aa1, Hspa4, nr3c1, nr3c2) showed sex-specific effects due to O 3 exposure. Baseline expression of HIP Fkbp4 was higher in females relative to males. O 3 inhibited Nr3c1 in female HIP and male HYP, but Nr3c2 was inhibited in male HYP. Fkbp4 expression was higher in O 3 -exposed females when compared to matched males, whereas Fkbp5 was expressed at higher levels in both brain regions of males and females. These results indicate that sex-specific brain region responses to O 3 might, in part, be caused by OS and regulation of glucocorticoid signaling.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Stress-Controlled Creep–Fatigue of an Advanced Austenitic Stainless Steel at Elevated Temperatures

Creep–fatigue interaction occurs in many structural components of high-temperature systems operating under cyclic and steady-state service conditions, such as in nuclear power plants, aerospace, naval, and other industrial applications. Thus, understanding micromechanisms governing high-temperature creep–fatigue behavior is essential for safety and design considerations. In this work, stress-controlled creep–fatigue tests of advanced austenitic stainless steel (Alloy 709) were performed at a 400 MPa stress range and 750 °C with tensile hold times of 0, 60, 600, 1800, and 3600 s, followed by microstructural examinations. The creep–fatigue lifetime of the Alloy 709 was found to decrease with increasing hold time until reaching a saturation level where the number of cycles to failure did not exhibit a significant decrease. Softening behavior was observed at the beginning of the test, possibly due to the recovery of entangled dislocations and de-twining. In addition, hysteresis loops showed ratcheting behavior, although the mean stress was zero during creep–fatigue cycling, which was attributed to activity of partial dislocations. Microstructural examination of the fracture surfaces showed that fatigue failure dominated at small hold times where the cracks initiated at the surface of the sample. Larger creep cracks were found for longer hold times with a lower probability of dimpled cavities, indicating the dominance of creep deformation. The results were compared with other commonly used stainless steels, and plausible reasons for the observed responses were described.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2021

Nuclear Translocation of Soybean MPK6, GmMPK6, Is Mediated by Hydrogen Peroxide in Salt Stress

The plant mitogen-activated protein kinase (MPK) cascade, a highly conserved signal transduction system in eukaryotes, plays a crucial role in the plant’s response to environmental stimuli and phytohormones. It is well-known that nuclear translocation of MPKs is necessary for their activities in mammalian cells. However, the mechanism underlying nuclear translocation of plant MPKs is not well elucidated. In the previous study, it has been shown that soybean MPK6 (GmMPK6) is activated by phosphatidic acid (PA) and hydrogen peroxide (H 2 O 2 ), which are two signaling molecules generated during salt stress. Using the two signaling molecules, we investigated how salt stress triggers its translocation to the nucleus. Our results show that the translocation of GmMPK6 to the nucleus is mediated by H 2 O 2 , but not by PA. Furthermore, the translocation was interrupted by diphenylene iodonium (DPI) (an inhibitor of RBOH), confirming that H 2 O 2 is the signaling molecule for the nuclear translocation of GmMPK6 during salt stress.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Combined-Accelerated Stress Testing for Advanced Reliability Assessment of Photovoltaic Modules

New and previously undiscovered degradation mechanisms continue to be identified after field exposure in new photovoltaic module designs or materials oftentimes results in significant losses in investment. This is despite passing certification tests. Testing is insufficient largely due to their single-or double-stress nature. A Combined-Accelerated Stress Test (C-AST) has recently been developed. The test combines multiple stress factors of the natural environment to better replicate conditions experienced by modules in the field and detect mechanisms not a-priori known in new materials and designs.

accelerator factor modeling↗
DOE OSTI2021

Design Guidelines for Predicting Stress in Cemented Doublets Undergoing Temperature Change, Part 2

This work builds on prior work that developed a methodology for evaluating thermal stress in cemented doublets. The prior studies were limited by a paucity of actual test data, particularly from thermally tested cemented doublets. This follow-on study uses the existing methodology to estimate stresses in cemented doublets that have been tested for a temperature range from –40°C to 85°C and establishes safe stress levels using actual data. We also discuss limitations and concerns that we need to address to improve our understanding of cemented doublet failure.

36 MATERIALS SCIENCE↗