Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “Plant Transformation”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 541 records · Page 30
All sourcesNASA NTRSDOE OSTI
DOE OSTI2019

Creating Cybersecurity Professionals of the Future

Cybersecurity is a growing public concern with more threats and vulnerabilities being discovered and exploited by adversaries each day. In particular, industrial control systems (ICS) are at a higher risk because their components were not designed with cybersecurity in mind. With increased risk to ICS, it is vital that the employees who work on the system are trained in cybersecurity best practices and the latest threats. Research has shown that there are currently no curriculum standards for an ICS cybersecurity professional, which may contribute to the issues faced during the hiring process. In fact, most individuals require extensive post-hire training before they can begin normal operations. The goal in cybersecurity is to become operationally resilient, which means in part that employees of an organization are trained to prevent and handle a cybersecurity incident. Therefore, the authors present a project that offers a solution to the education gap by creating a workforce pipeline for ICS cybersecurity professionals. The project is a virtual ecosystem for collaboration and transforming operational resilience (VECTOR). VECTOR incorporates many different efforts to increase operational resilience including the development of ICS cybersecurity curriculum and apprenticeships.

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Critical Component/Technology Gap in 21 st Century Power Plant Gasification Based Polygeneration: Advanced Ceramic Membranes/Modules for Ultra Efficient Hydrogen (H 2 ) Production/Carbon Dioxide (CO 2 ) Capture for Coal-Based Polygeneration

The 21 st Century Power Plant Gasification Based Polygeneration power plant layout is a relatively straightforward retrofit of well-established ammonia synthesis technology to the baseline IGCC process and envisions co-production of power and chemicals from coal in the context of carbon capture. A Dual Stage Membrane Process (DSMP) for pre-combustion CO 2 capture in a coal fired IGCC power plant has been demonstrated by Media and Process Technology Inc (MPT) (DE-FE0013064) in bench-scale live gas testing at the NCCC. This work, however, highlighted the importance of permeate purge capability to deliver deep H 2 recovery at moderate pressures and high carbon capture performance. Further, in the area of warm gas processing, a permeate purgeable membrane support for a wide range of inorganic high-performance membrane materials (CMS, Pd-alloy, zeolite, ZIF, graphene, etc.) was not available and hence had been a common and significant barrier to their commercialization. Hence, the Critical Technology Gap to implementing the DSMP in the Polygeneration power plant and more broadly in advanced warm gas separation applications was the inability to permeate purge the membranes coupled with the lack of the availability of a high packing density scalable package design. To overcome this Critical Technology Gap, in this project, the primary objective was the development of a permeate purgeable full ceramic support for these high-performance inorganic membranes and the complementary high packing density housing. Our goal and approach were to extend our “candle filter” design to a “dual end open” package to enable permeate purge and scalability. Microporous ceramic membranes have been proven to be a low cost, stable material for high temperature applications under harsh environment. They are the leading support choice of researchers in advanced inorganic membrane development in applications such as pre-combustion CO 2 capture. The new 2nd Generation “dual end open” bundle developed in this project is a universal support for these existing and emerging inorganic membrane technologies that up to now have lacked a pathway out of the laboratory. The full ceramic permeate purgeable support represents a transformational technology and opens the door to commercialization of these advanced membrane materials in a wide array of mega scale commercial applications in gas (and liquid) processing under aggressive conditions not suited to conventional polymeric membranes.

01 COAL, LIGNITE, AND PEAT↗
DOE OSTI2020

Knocking Out the Wall: Revised Protocols for Gene Targeting in Physcomitrella patens

The moss Physcomitrella patens has become established as a model for investigating plant gene function due to the feasibility of gene targeting. The chemical composition of the P. patens cell wall is similar to that of vascular plants and phylogenetic analyses of glycosyltransferase sequences from the P. patens genome have identified genes that putatively encode cell wall biosynthetic enzymes, providing a basis for investigating the evolution of cell wall polysaccharides and the enzymes that synthesize them. Here, the protocols described in this chapter provide methods for targeted gene knockout in P. patens, from constructing vectors and maintaining cultures to transforming protoplasts and analysing the genotypes and phenotypes of the resulting transformed lines.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Gene family expansions and transcriptome signatures uncover fungal adaptations to wood decay

Because they comprise some of the most efficient wood-decayers, Polyporales fungi impact carbon cycling in forest environment. Despite continuous discoveries on the enzymatic machinery involved in wood decomposition, the vision on their evolutionary adaptation to wood decay and genome diversity remains incomplete. We combined the genome sequence information from 50 Polyporales species, including 26 newly sequenced genomes and sought for genomic and functional adaptations to wood decay through the analysis of genome composition and transcriptome responses to different carbon sources. The genomes of Polyporales from different phylogenetic clades showed poor conservation in macrosynteny, indicative of genome rearrangements. We observed different gene family expansion/contraction histories for plant cell wall degrading enzymes in core polyporoids and phlebioids and captured expansions for genes involved in signalling and regulation in the lineages of white rotters. Furthermore, we identified conserved cupredoxins, thaumatin-like proteins and lytic polysaccharide monooxygenases with a yet uncharacterized appended module as new candidate players in wood decomposition. Given the current need for enzymatic toolkits dedicated to the transformation of renewable carbon sources, the observed genomic diversity among Polyporales strengthens the relevance of mining Polyporales biodiversity to understand the molecular mechanisms of wood decay.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS1981

Soybean canopy reflectance as influenced by cultural practices

Experiments were conducted at West Lafayette, Indiana in 1978 and 1979 to study the reflectance factor of soybean canopies as affected by differences in row width, population, planting date, cultivar and soil type. Reflectance factor data were acquired throughout the growing season with a LANDSAT-band radiometer. Agronomic data included plant height, leaf area index, development stage, total fresh and dry biomass, percent soil cover, and grain yield. The results indicate that row width, planting date, and cultivar influence the percent soil cover, leaf area index, and biomass present, which are in turn related to the multispectral reflectance. Additionally, the reflectance data were quite sensitive to the onset of senescence. Soil color and moisture were found to be important factors influencing the reflectance in single LANDSAT bands, but the near infrared/red reflectance ratio and the greeness transformation were less sensitive than the single bands to the soil background present.

Bauer, M. E.↗
NASA NTRS1987

Nitrogen transformations following tropical forest felling and burning on a volcanic soil

Nitrogen transformations and loss were measured following forest clearing in a relatively fertile tropical forest site. Nitrogen mineralization, nitrification, and amounts of ammonium and nitrate increased substantially in surface soils during the 6 mo following burning, then returned to background levels. The nitrogen content of microbial biomass declined to half its original value 6 mo after clearing and remained low in the cleared sites. Plant uptake of nitrogen was substantial on cleared plots (50 g/sq m), but it accounted for only 18 percent of N-15 label added to field plots. MIcrobial immobilization of N-15 was small relative to that in a cleared temperate site, and measurements of denitrification potentials suggested that relatively little mineralized nitrogen was lost to the atmosphere. Substantial amounts of nitrogen (40-70 g/sq m) were retained as exchangeably bound nitrate deep in the soils of a cleared plot on which revegetation was prevented; this process accounted for 12 percent of the N-15 label added to field plots.

Matson, Pamela A.↗
DOE OSTI2021

Pulse Detonation Engine for Advanced Oxy-Combustion of Coal-Based Fuel for Direct Power Extraction Applications

Pressure gain combustion and magnetohydrodynamic (MHD) systems have the potential to provide a step increase in the efficiency of combined-cycle power plants. Specific advantages include a net pressure increase to the system instead of a pressure drop, the high temperature of the detonation waves can increase the efficiency of power extraction compared to other processes, significant thermal energy can be released in a compact region, and the high velocities of the flow increase extraction of electrical power. In summary, a pressure gain combustor coupled with a MHD has the potential to be transformative. Despite the potential advantages, relatively little research has been conducted considering coupled pressure gain combustion systems with MHD systems. With this background and motivation, the overall goal of this effort was to advance the knowledge, technology, and computational tools associated with coupled detonation and MHD systems. A joint experimental and computational approach was used while seeking to accomplish the goals of this work. Specifically, two pulse detonation engines were developed and used for the experiments to produce detonations. Detonation speeds were measured for a variety of flow and fuel conditions (e.g., methane, propane, with coal particles). Preliminary electrical conductivity measurements were collected. An extensive amount of research was performed to identify sensitivities of detonation behaviors to the presence of combustion products. Computationally, a twofold approach was used in this work. First, a solver was developed for solving the governing equations for a reactive flow with coupled detonation and ionization chemistry. The solver was applied to study the impacts of seed material ionization on detonation. Second, a conservation element-solution element (CE-SE) based numerical solver for detonation studies with a reduced reaction mechanism for oxy-methane combustion was developed and verified on standard test cases. Key findings and contributions from this work are as follows. A system was developed for injecting powderized coal, or other seeding material, into a pulse-detonation system. The influence of a combustion product (i.e., CO 2 ) on detonation behavior was identified. Knowledge gained from this work is applicable to devices such as rotating detonation engines, where combustion products mix with fresh reactants. A system for measuring the electrical conductivity of the exhaust from a pulse-detonation engine was developed. The open-source solver, Clawpack, was extended to solve the reactive Euler equations for simulating detonations. A coupled combustion and ionization chemistry was developed in a single chemical kinetic model for methane oxidation. This model can be used to solve coupled MHD and detonation simulations. It was found that parasitic interactions from ionization chemistry with the magnetic field can reduce the detonation velocity by up to 8%, with a potential impact on power extraction of 15%. It is recommended that interactions between the detonation front and MHD field be considered. Higher gas temperatures and velocities were achieved owing to oxy-fuel detonations. Use of radical dissociation reactions in the reduced reaction mechanism, was found to be critical in predicting detonation temperature and velocity accurately.

01 COAL, LIGNITE, AND PEAT↗
DOE OSTI2024

EverGREEN 2045: An Energy Mix to Decarbonize Washington State

Washington State’s future resource mix is likely to be comprised of intermittent renewables and carbon-free generation including hydropower by 2045. Generation will likely be comprised of wind, solar photovoltaic (PV), batteries, pumped storage hydropower (PSH), existing nuclear power plants, and potentially enhanced geothermal systems and advanced nuclear reactor technologies. To assess the cost and stability of the future resource mix, we partner with X-energy (advanced reactor design) and AltaRock Energy (enhanced geothermal system) for proprietary cost data. After estimating the costs of these two new technologies, we design plausible future resource mix scenarios to meet Washington State’s Clean Energy Transformation Act which transitions the state to carbon-free generation by 2045. We assess the cost and stability of the future resource mix with power system analysis tools, finding revenues are sufficient to cover variable operating and maintenance costs for most technologies providing power in 2030 and 2045, but capacity payments or power purchase agreements will likely be necessary for flexible resources, including enhanced geothermal systems and advanced nuclear reactors, to participate in the future resource mix.

29 ENERGY PLANNING, POLICY, AND ECONOMY↗
DOE OSTI2026

Microchannel-based Membrane-less Extraction of Li from Unconventional Lithium Sources & the Separation of REE

This final report provides an overview of the Project's entire duration, covering July 1, 2021 to December 31, 2023. It primarily focuses on the achievements, technological developments, and unique challenges the team faced while working on separating and extracting Lithium from produced waters. The project's primary aim was to create an integrated, high-throughput, membrane-less, and modular microfluidic platform that could extract Lithium from unconventional sources. We have successfully met all goals and milestones envisioned in the SOPO document. The most critical primary milestones, including the Go-No-Go milestone (refer to the Gantt chart in the Appendices), were successfully accomplished. We demonstrated phase separation (>90%) and extraction (>85%) performance in the MPSE using synthetic, and representative produced water composition feed at 50 ml/min total flow through MPSE 36. We have also performed a parametric study of the MPSE operations, beyond the scope of SOPO, exploring operating conditions of current and broader interest. The extended investigation of operational parameters is concurrent with our efforts to seek further development of the MPSE technology beyond the scope of the Project. Along these lines of development, we have made efforts to be responsive to DOE calls for technological developments of other types of resources (beyond PW) for the recovery of Critical Materials and higher TRL development (beyond TRL 4). During the work on this Project, we developed and implemented three innovative technical approaches that emerged from our efforts to successfully meet the Project milestones. The innovative & original technical approaches developed and implemented in this Project are now the contributions to process engineering that could be clearly credited to the Project. First, Convergent Design Approach is a comprehensive feedforward & feedback loop of four design phases: i) design for functionality, ii) design for manufacturing, iii) design for sustainability, and iv) design for market. Next was Process Intensification. A major aim of this Project was to create an innovative phase separation & extraction microscale-based technology for Li separation – thus the words microchannel-based in the Project title. A microscale-based technology is intrinsically in the center of the Process Intensification domain as defined by its unique principles. Therefore, Process Intensification was implicitly envisioned in the Project’s SOPO. Lastly, Time Scale Analysis is a novel tool for discovering the needs and directions of Process Intensification implementations in any process technology. This Project is fully credited for developing and implementing the three novel technical approaches mentioned above. These are general contributions to process engineering that emerged from this Project. Beyond the original SOPO scope, the OSU-U.Pitt research group utilized a Convergent Design methodology, integrating first-principles mathematical modeling with experimental validation on the Minimum Development Vehicle. By creating these Digital Twins, the team rapidly assessed manufacturing iterations to support TEA analysis. This framework further enabled the development of advanced Surface Modification Techniques, where hydrophobic and oleophobic coating strategies were optimized via Digital Twin tools and validated through rigorous 100-hour longevity testing. TEA Analysis: The closing efforts of this Project were focused on the TEA analysis. TEA analysis had two primary functions: i) enabling critical assessments of design variations withing 10 the Concurrent Design Approach, thus enabling evolution of the MPSE design to reach faster- better-cheaper alternatives; and ii) to create a bridge between the accomplishments of this Project and future projects of higher TRL, beyond TRL 6 level. It is important to note that the TEA model created in the Project stirred the technological solutions for the recovery of critical materials toward a vision of a very profitable modular plant that has unique zero-waste water discharge signature. More importantly, thanks to our experimental performance data and conservative assumptions, the TEA model predicts minimal technological and investment risks. Low cost of a modular unit of a nominal capacity of [1000 tons of Li 2 CO 3 /year] positions the MPSE based technology within the reach of community investors, thus offering a paradigm shift in the development of critical technologies. The project successfully navigated two primary challenges: solvent selection and manufacturing adaptation. Restricted by the SOPO to existing literature for lithium recovery, the team identified a critical need for a "material excellence program" to develop next-generation solvents, eventually concluding with a preliminary investigation into promising Ionic Liquids (ILs). Simultaneously, COVID-19 supply chain disruptions forced a pivot from traditional manufacturing to advanced additive methods at ATAMI-OSU. By transitioning from stainless steel to 3D-printed polymer substrates, the team achieved a transformative three-order-of- magnitude reduction in manufacturing costs and compressed prototyping timelines from several months to just two days. The MPSE technology offers significant energy, environmental, and economic advantages by overcoming the traditional bottlenecks of phase-separation hardware and contactor size. Unlike conventional mixer-settlers or membrane-based systems, MPSE operates without moving parts or fouling-prone membranes, achieving robust performance even with challenging, viscous, or particulate-heavy feeds. Key performance metrics include an energy intensity reduction of 5–50x (3–40 kJ/m 3 ) compared to incumbent technologies and a dramatic reduction of processing time to under 60 seconds, which drastically reduces the physical plant footprint. These technical efficiencies translate into superior economic outcomes; for a 100 t/year Li 2 CO 3 facility, implementing MPSE is projected to nearly halve contactor CAPEX (from $\$$6.08M to $\$$3.01M) and significantly increase the project's Net Present Value (NPV), derisking new investment and enabling distributed critical-mineral processing configurations. The commercialization of MPSE technology is being spearheaded by Vigsur Dynamics Inc., which has adopted a structured, parallel approach to technical and business development since its formation in January 2026. Following extensive customer discovery and engagement with the Oregon State University accelerator, Vigsur Dynamics is working to establish a business model that transitions from pilot demonstrations to modular hardware sales, ultimately aiming for a "build-own-operate" service strategy. Current technical milestones—including 100 hours of continuous operation, superior energy efficiency, and successful 6-unit modular scale-up— provide a foundation for this transition. Backed by ongoing IP licensing and a growing network of industrial and venture advisors, the company is actively de-risking the platform to replace conventional mixer-settler systems in the critical minerals market.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2025

DOE Challenges and Opportunities Associated with Accountable Nuclear Material Needs for Development and Commercialization of Fusion Nuclear Energy

Fusion energy represents a transformative opportunity to deliver a safe, plentiful, and carbon-free source of reliable primary power. In recent years, fusion research and development have accelerated significantly, particularly within the US, driven by decades of foundational public investment. Notably, in 2024 the US Department of Energy (DOE) established a comprehensive Fusion Energy Strategy aimed at collaborating with industry partners to enable the deployment of fusion power plants and grid integration by the 2030s. This strategy is chiefly implemented through the DOE Office of Science (SC) Fusion Energy Sciences program. This project was initiated to identify potential approaches for the Office of Environment, Safety, and Health (NA-ESH-12) within DOE’s National Nuclear Security Administration to begin engagement with the fusion community on future accountable material needs. The goal of the project is to inform and influence the supply of and demand for accountable nuclear materials as fusion energy is developed and commercialized. NA-ESH-12 must proactively engage with the fusion community regarding the production and management of accountable nuclear materials. Given the complexity and scale of materials required for research, pilot projects, and eventual commercial reactors, early coordination is vital. The project’s objective is to provide insights that will shape the supply and demand landscape for critical nuclear materials, ensuring that DOE is prepared to effectively support fusion energy development and commercialization. In FY 2025, an initial limited review was conducted to identify the status of the fusion energy community’s progress toward full-scale energy production and the need for accountable nuclear material. This included communications with SC, NA-ESH-12, Savannah River National Laboratory, and Oak Ridge National Laboratory, and attending the Rutgers University–sponsored Supply Chain Workshop: Scaling the Fusion Industry and the International Atomic Energy Agency’s Ninth DEMO Programme Workshop. The review to date indicates that the amounts of tritium, lithium-6, and deuterium required by the fusion industry will be dependent on fuel type, breeding technology, blankets, and R&D improvements. One concern is that the commercial sector does not have a sufficient supply chain to meet the demand for development and commercialization for fusion energy production. The supply and demand estimates for these materials should be routinely reviewed as fusion technologies mature.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2023

A portable ion-energy diagnostic for transformative ARPA-E Fusion R&D

The Princeton Plasma Physics Laboratory seeks to develop a diagnostic to measure the energy distribution of ions (IED) in innovative confinement concept devices being investigated under ARAP-E grants. The Princeton Field-Reversed Configuration (PFRC) fusion project aims to develop small, simple, and clean fusion power generators in the 1–10 MW “micro-reactor” class. The PFRC explores a new approach to fusion power-generation design, prioritizing low radioactivity and modular units of MEW-scale power output. The team’s proposed power plant design provides a small footprint for a compact, potentially transportable energy source that is fully deployable and emissions-free. A critical diagnostic to accomplish this mission and to test the theory of ion heating necessary for fusion in PFRC reactors is called a stripping-cell ion-energy analyzer (SC-IEA).

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2022

A review of active probing-based system identification techniques with applications in power systems

System identification is becoming a relevant research area for numerous applications in power grids due to the increasing complexity of the system. A paradigm shift in power system infrastructure driven by renewable energy resources, controllable loads, and new power electronics technologies have given rise to new challenges in power systems operation and control. This increased complexity of power systems and unavailability of physics-based models of most inverter-based resources requires that traditional modeling of power systems approaches be complemented by system identification-based black or grey box modeling techniques. In light of the importance of system identification and little attention paid to the applications of these techniques in transforming power systems, this paper provides a comprehensive review of active probing-based system identification methods in the context of power system applications. It reviews applications of both linear and nonlinear system identification with discussion on their potential and key takeaways. To motivate a further practical use in power systems, the paper provides an example of system identification, to develop a state space model of an unknown plant with step-by-step details. The paper highlights the advantages of using modern power electronics-based sources in the identification process and discusses the emerging research directions for future.

24 POWER TRANSMISSION AND DISTRIBUTION↗
DOE OSTI2023

MEASUR Up: Identifying opportunities in a facility

The commercial and industrial sectors account for nearly half of the total U.S. energy consumption. To help these sectors reduce their energy intensity, the U.S. Department of Energy (DOE) designed the Better Buildings, Better Plants Initiative. Through this initiative, more than 900 industrial, commercial, public and residential organizations commit to long-term sustainability goals and share their proven energy efficiency strategies, which inspire others to tap into the continued potential for energy efficiency. Collectively, these organizations have saved 2.5 quadrillion BTUs of energy, equivalent to US$15.3 billion, and 155 million metric tons of carbon dioxide. Within the initiative, the Better Plants side of the program focuses specifically on the industrial sector. More than 270 industrial partners have taken advantage of the unique selection of resources offered including workforce development programs, information sharing, peer-to-peer networking, diagnostic tool loans and software tools. One of the most powerful tools off ered is a revitalization of the legacy DOE software tools used by industry for decades. These have been transformed into a new, free, opensource software tool suite: MEASUR (Manufacturing Energy Assessment Software for Utility Reduction)

Armstrong, Kristina↗
DOE OSTI2022

The Arabidopsis T‐DNA mutant SALK_008491 carries a 14‐kb deletion on chromosome 3 that provides rare insights into the plant response to dynamic light stress

Abstract In nature, plants experience rapid changes in light intensity and quality throughout the day. To maximize growth, they have established molecular mechanisms to optimize photosynthetic output while protecting components of the light‐dependent reaction and CO 2 fixation pathways. Plant phenotyping of mutant collections has become a powerful tool to unveil the genetic loci involved in environmental acclimation. Here, we describe the phenotyping of the transfer‐DNA (T‐DNA) insertion mutant line SALK_008491, previously known as nhd1‐1 . Growth in a fluctuating light regime caused a loss in growth rate accompanied by a spike in photosystem (PS) II damage and increased non‐photochemical quenching (NPQ). Interestingly, an independent nhd1 null allele did not recapitulate the NPQ phenotype. Through bulk sequencing of a backcrossed segregating F 2 pool, we identified an ~14‐kb large deletion on chromosome 3 (Chr3) in SALK_008491 affecting five genes upstream of NHD1 . Besides NHD1 , which encodes for a putative plastid Na + /H + antiporter, the stromal NAD‐dependent D‐3‐phosphoglycerate dehydrogenase 3 ( PGDH3 ) locus was eradicated. Although some changes in the SALK_008491 mutant's photosynthesis can be assigned to the loss of PGDH3, our follow‐up studies employing respective single mutants and complementation with overlapping transformation‐competent artificial chromosome (TAC) vectors reveal that the exacerbated fluctuating light sensitivity in SALK_008491 mutants result from the simultaneous loss of PGDH3 and NHD1. Altogether, the data obtained from this large deletion‐carrying mutant provide new and unintuitive insights into the molecular mechanisms that function to protect the photosynthetic machinery. Moreover, our study renews calls for caution when setting up reverse genetic studies using T‐DNA lines. Although second‐site insertions, indels, and SNPs have been reported before, large deletion surrounding the insertion site causes yet another problem. Nevertheless, as shown through this research, such unpredictable genetic events following T‐DNA mutagenesis can provide unintuitive insights that allow for understanding complex phenomena such as the plant acclimation to dynamic high light stress.

Lopez, Laura S.↗
DOE OSTI2024

Development of Self-Assembly Supports Enabling Transformational Membrane Performance for Cost-Effective Carbon Capture

This final technical report describes work conducted by Membrane Technology and Research, Inc. (MTR) for the U.S. Department of Energy (DOE), National Energy Technology Lab (NETL) on the development of membranes with transformational performance for carbon capture under award number DE-FE0031596. The work was performed from June 1, 2018 through May 31, 2024. For more than a decade, MTR has worked in partnership with DOE to develop an innovative membrane-based CO 2 capture process. This effort has included the first test of membrane modules with coal-fired flue gas at the Arizona Public Services (APS) Cholla plant in 2010; the accumulation of >11,000 hours of flue gas operation for Polaris modules on a bench-scale 1 tonne/day (TPD) system at the National Carbon Capture Center (NCCC); scale-up of first-generation (Gen-1) Polaris to a 20 TPD small pilot system, and successful operation of this system on a flue gas slipstream at NCCC and in integrated boiler testing at Babcock & Wilcox (B&W). Through continued development efforts, a second-generation (Gen-2) version of the Polaris membrane has been scaled-up to pilot production. This membrane offers 70% higher CO 2 permeance with similar selectivity to the base case Polaris. MTR also developed planar modules designed specifically for the low-pressure, high-volumetric flow rate process conditions of flue gas operation. These new modules have significantly lower pressure-drop values compared to the type originally used (spiral-wound modules), which results in significant energy savings. The goal of the work described in this report was to improve on the Polaris Gen-2 membrane with the ultimate aim to reduce the cost of carbon capture. The majority of the effort was to develop improved support membranes for the multi-layer composite structure of MTR’s Polaris membrane. Earlier work at MTR had identified the support structure as limiting membrane permeances, not because the support itself represents a permeation resistance, but because the distribution of pores at the surface of the support imposes a geometric restriction to diffusion in the layers above it. Support membranes were prepared from a range of polymers, including commercially available block copolymers and a custom synthesized block copolymer alternative. The best support membranes developed in this project reduced the geometric restriction by a factor of two to three. These supports then were used to produce Polaris composite membranes with improved permeances. The second topic was to create a high-selectivity version of the Polaris membrane. The high-selectivity version uses a novel selective polymeric material and high selectivities were confirmed in experiments at MTR. The material is not easily made into very thin films. Consequently, the permeances are significantly lower than the Polaris Gen-2 membrane. The utility of this membrane is therefore limited to the carbon dioxide purification step that produces liquid CO 2 . A Technical and Economic Analysis (TEA) was performed for a carbon capture system that uses both advanced membrane types. The TEA shows the novel advanced membranes reduce the cost of capture by 10%, from $63.32/tonne CO 2 to $56.90/tonne CO 2 (2022 USD). Most of the development work was carried out with laboratory-scale casting and coating equipment. A number, but not all, of the improvements identified have been implemented on commercial-scale manufacturing equipment. The focus of future work at MTR is to incorporate the advancements made into the Polaris membrane manufacturing process.

01 COAL, LIGNITE, AND PEAT↗
DOE OSTI2025

Summary of Factory Fueling and Testing Risks to Support the Transformation of Regulatory Requirements for Microreactors

Microreactors have the potential to open new markets and applications for nuclear energy. New manufacturing and operational regimes, such as factory fueling and testing prior to site installation, are being proposed to meet these new markets. The radiological hazards associated with traditional commercial power reactors are not the same as the hazards of a reactor being constructed in a factory. Currently, a reactor operating license specified under 10 CFR Part 50, Part 52, or (in the near future) Part 53 is required prior to loading fuel in the reactor. This is logical for plants that are immediately to begin full-power operations soon after fuel loading. However, for microreactors, this may not be the case. Some deployment concepts may stage reactors as “ready to go” in a factory prior to site installation and startup. This approach is being considered in the case of diesel generator replacements, mobile or roaming mining operations, and emergency response situations, such as after a major disaster event. Therefore, it is necessary to evaluate hazards assuming low power operation for a short irradiation time. This report investigates the primary hazards unique to microreactors associated with low power reactor and physics tests necessary to confirm core safety assumptions, neutronic and core design performance parameters, and other assumptions.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2021

Gaussian-preserved, non-volatile shape morphing in three-dimensional microstructures for dual-functional electronic devices

Motile plant structures such as Mimosa pudica leaves, Impatiens glandulifera seedpods, and Dionaea muscipula leaves exhibit fast nastic movements in a few seconds or less. This motion is stimuli-independent mechanical movement following theorema egregium rules. Artificial analogs of tropistic motion in plants are exemplified by shape-morphing systems, which are characterized by high functional robustness and resilience for creating 3D structures. However, all shape-morphing systems developed so far rely exclusively on continuous external stimuli and result in slow response. Here, we report a Gaussian-preserved shape-morphing system to realize ultrafast shape morphing and non-volatile reconfiguration. Relying on the Gaussian-preserved rules, the transformation can be triggered by mechanical or thermal stimuli within a microsecond. Moreover, as localized energy minima are encountered during shape morphing, non-volatile configuration is preserved by geometrically enhanced rigidity. Using this system, we demonstrate a suite of electronic devices that are reconfigurable, and therefore, expand functional diversification.

36 MATERIALS SCIENCE↗