Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “POPLARS”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3
All sourcesNASA NTRSDOE OSTI
DOE OSTI2018

Overexpression of PtABCC1 contributes to mercury tolerance and accumulation in Arabidopsis and poplar

Highlights: • Overexpression of PtABCC1 enhanced Hg tolerance in Arabidopsis and poplar. • Overexpression of PtABCC1 enhanced Hg accumulation in Arabidopsis and poplar. • PtABCC1 was the first identified poplar ABC transporter for phytoremediation of Hg. Mercury (Hg) is a highly biotoxic heavy metal that contaminates the environment. Phytoremediation is a green technology for environmental remediation and is used to clean up Hg contaminated soil in recent years. In this study, we isolated an ATP-binding cassette (ABC) transporter gene PtABCC1 from Populus trichocarpa and overexpressed it in Arabidopsis and poplar. The transgenic plants conferred higher Hg tolerance than wild type (WT) plants, and overexpression of PtABCC1 could lead to 26–72% or 7–160% increase of Hg accumulation in Arabidopsis or poplar plants, respectively. These results demonstrated that PtABCC1 plays a crucial role in enhancing tolerance and accumulation to Hg in plants, which provides a promising way for phytoremediation of Hg contamination.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Simultaneous Overexpression of FERULOYL‐CoA 6′‐HYDROXYLASE 1 and COUMARIN SYNTHASE Leads to Coumarin‐Enriched Lignin and Improved Saccharification in Greenhouse‐ and Field‐Grown Poplar

ABSTRACT The urgent need for renewable resources has increased the interest in woody biomass to manufacture bio‐based products. However, lignin recalcitrance limits the enzymatic conversion of wood into fermentable sugars, posing a major challenge for biomass deconstruction. To address this problem, we aimed at incorporating the coumarin scopoletin into the lignin polymer of poplar ( Populus tremula × P . alba ) by expressing FERULOYL‐CoA 6′‐HYDROXYLASE 1 ( F6′H1 ) and COUMARIN SYNTHASE ( COSY ) in lignifying cells. Three constructs were evaluated: two bicistronic constructs, SCOP1 ( COSY followed by F6′H1 ) and SCOP2 ( F6′H1 followed by COSY ), and one monocistronic, SCOP3 (only F6′H1 ). SCOP1 poplars produced most free scopoletin without altering overall lignin, cellulose or hemicellulose content. SCOP2 poplars were overall less efficient in scopoletin production and most of these lines showed a severe biomass yield penalty, whereas SCOP3 caused plant lethality. NMR and metabolic analyses confirmed that scopoletin cross‐coupled with G and S monomers during lignification in SCOP1 lines. In addition to scopoletin, the detection of benzodioxane structures revealed the incorporation of dihydroxycoumarins. Overall coumarin incorporation in lignin amounted up to 2.3%. After alkaline pretreatment, wood from greenhouse‐grown SCOP1 poplars released up to 29% more glucose compared to the wild type upon limited saccharification. Field‐testing of three SCOP1 lines showed a 6 to 11% increase in saccharification efficiency, with the line containing the lowest scopoletin levels maintaining normal growth. These results demonstrate that engineering lignin composition in poplar can improve saccharification, and emphasize the importance of construct design, translational research and field validation.

alternative lignin monomers↗
DOE OSTI2019

Imaging Changes in Cell Walls of Engineered Poplar by Stimulated Raman Scattering and Atomic Force Microscopy

Lignin is a major impediment in the deconstruction of plant biomass to its soluble monomeric constituents. Modification of the lignin biosynthetic pathway has proven to be an effective means of reducing biomass recalcitrance but can often result in impaired growth. As one of the successful instances of “designer” biomass, “Zip-lignin” has been generated in poplar to introduce ester linkages into the lignin backbone. The resulting plants grow normally and have improved biomass deconstructability, especially under mild alkaline conditions that can effectively cleave the uniquely introduced ester bonds. In order to further understand the structural and chemical features that may be associated with the observed improved processing efficiency, we used hyperspectral stimulated Raman scattering (hsSRS) to map the Zip-lignin in planta using lignin conjugated α–β carbon double bonds as the proxy. Such double bonds are introduced in all types of lignin, but unique structures in Zip-lignins experience a ~20 cm –1 shift from 1650 to 1630 cm –1 in their Raman spectra due to the conjugation between the double bond and an associated ester carbonyl group. Analysis of the hsSRS images has revealed that the Raman signal specifically representing Zip-lignin can be estimated. Moreover, it exhibits a distribution pattern in cell wall layers similar to that of the native lignin, but its intensity varies in different transgenic poplar lines. In addition, when the cell walls are imaged by atomic force microscopy and Simons’ staining, we found that the poplar containing the Zip-lignin had increased accessible areas, which may be beneficial to the chemical penetration during pretreatment and substrate accessibility during enzymatic hydrolysis. Our work indicates that both physical and chemical modification of cell wall in Zip-lignin poplar could contribute to the observed improvements in sugar yields.

09 BIOMASS FUELS↗
DOE OSTI2020

Tensile properties of 3D-printed wood-filled PLA materials using poplar trees

Fabrication of renewable materials through additive manufacturing using wood-filled polylactic acid (PLA) is an emerging field of study. The variability in the tensile properties of 3D-printed materials due to the variability in woody biomass properties has not been studied. Biomass size reduction, filament extrusion, and 3D-printing methods were investigated to determine the conditions that resulted in consistent printing. Using 20% ball-milled poplar reinforcement in PLA, 210 °C filament extrusion temperature and 230 °C printing temperature were found to be the best conditions. Subsequently, seventy poplar samples from a common garden were used to test the tensile properties of the printed materials. The median tensile strength at yield was 50 MPa, with 5–95 percentiles ranged in 37–54 MPa. Strain% at break had a median value of 2.1%, and 5–95 percentiles were 1.7–2.7%. The median Young's modulus was 3.65 GPa, and 5–95 percentiles ranged in 2.9–4.1 GPa. Biomass density was correlated to composite density. Median particle size of ball-milled poplar was negatively correlated with tensile strength. Composite density affected tensile strength of the composite. β-glycosidic bond of polysaccharides in biomass affected Young's modulus of the composite. Overall, these data show that genotypic variation among Populus trichocarpa have substantial effect on tensile properties of 3D printed PLA-poplar materials.

36 MATERIALS SCIENCE↗
DOE OSTI2020

Expression of the Trichoderma reesei expansin-like protein, swollenin, in poplar results in biomass with improved sugar release by enzymatic hydrolysis

Ethanol production from lignocellulosic biomass has been considered an alternative to corn-based ethanol and fossil fuel. However, the secondary cell wall structure prevents efficient degradation of cellulose. Expression of cell wall degrading enzymes has been suggested as one solution to generate suitable feedstocks for lignocellulosic ethanol production. Swollenin (SWO), originating from Trichoderma reesei, disrupts cellulose structure with low-level hydrolytic activity to the glucan chain. Previously, characterization of T. reesei SWO has been carried out in multiple microorganisms and tobacco. This study heterologously overexpressed T. reesei SWO in hybrid poplar (Populus tremula × alba), a promising feedstock for biofuel production, under the control of either the constitutive Cauliflower Mosaic Virus 35S (CaMV 35S) promoter or the putative vascular tissue specific Subterranean Clover Stunt Virus S7 (SCSV) promoter. Transgenic poplar lines with high or moderate SWO expression level showed abnormal growth and reduced biomass production, along with increased glucose and reduced lignin contents. Increased cellulose crystallinity was observed in two transgenic events. This study also investigated the effect of in planta SWO expression on cellulose saccharification efficiency and found that transgenic events improved glucan conversion rates compared to wild type poplar. The results suggest SWO-overexpressing transgenic poplar lines could be a potential feedstock for ethanol production.

09 BIOMASS FUELS↗
DOE OSTI2022

Lignin-first biorefining of Nordic poplar to produce cellulose fibers could displace cotton production on agricultural lands

Here, we show that lignin-first biorefining of poplar can enable the production of dissolving cellulose pulp that can produce regenerated cellulose, which could substitute cotton. These results in turn indicate that agricultural land dedicated to cotton could be reclaimed for food production by extending poplar plantations to produce textile fibers. Based on climate-adapted poplar clones capable of growth on marginal lands in the Nordic region, we estimate an environmentally sustainable annual biomass production of ~11 tonnes/ha. At scale, lignin-first biorefining of this poplar could annually generate 2.4 tonnes/ha of dissolving pulp for textiles and 1.1 m 3 biofuels. Life cycle assessment indicates that, relative to cotton production, this approach could substantially reduce water consumption and identifies certain areas for further improvement. Overall, this work highlights a new value chain to reduce the environmental footprint of textiles, chemicals, and biofuels while enabling land reclamation and water savings from cotton back to food production.

09 BIOMASS FUELS↗
DOE OSTI2020

Transgenic Poplar Designed for Biofuels

Members of the genus Populus (i.e., cottonwood, hybrid poplar) represent a promising source of lignocellulosic biomass for biofuels. However, one of the major factors negatively affecting poplar’s efficient conversion to biofuel is the inherent recalcitrance to enzymatic saccharification due to cell wall components such as lignin. To this effect, there have been efforts to modify gene expression to reduce biomass recalcitrance by changing cell wall properties. Furthermore, we review recent genetic modifications of poplar that led to change cell wall properties and the resulting effects on subsequent pretreatment efficacy and saccharification. Although genetic engineering’s impacts on cell wall properties are not fully predictable, recent studies have shown promising improvement in the biological conversion of transgenic poplar to biofuels.

09 BIOMASS FUELS↗
DOE OSTI2019

Rhamnogalacturonan-I is a determinant of cell–cell adhesion in poplar wood

The molecular basis of cell–cell adhesion in woody tissues is not known. Xylem cells in wood particles of hybrid poplar (Populus tremula 9 P. alba cv. INRA 717-1B4) were separated by oxidation of lignin with acidic sodium chlorite when combined with extraction of xylan and rhamnogalacturonan-I (RG-I) using either dilute alkali or a combination of xylanase and RG-lyase. Acidic chlorite followed by dilute alkali treatment enables cell–cell separation by removing material from the compound middle lamellae between the primary walls. Although lignin is known to contribute to adhesion between wood cells, we found that removing lignin is a necessary but not sufficient condition to effect complete cell–cell separation in poplar lines with various ratios of syringyl:guaiacyl lignin. Transgenic poplar lines expressing an Arabidopsis thaliana gene encoding an RG-lyase (AtRGIL6) showed enhanced cell–cell separation, increased accessibility of cellulose and xylan to hydrolytic enzyme activities, and increased fragmentation of intact wood particles into small cell clusters and single cells under mechanical stress. Our results indicate a novel function for RG-I, and also for xylan, as determinants of cell–cell adhesion in poplar wood cell walls. Genetic control of RG-I content provides a new strategy to increase catalyst accessibility and saccharification yields from woody biomass for biofuels and industrial chemicals.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗
DOE OSTI2019

A Novel Poplar Biomass Germplasm Resource for Functional Genomics and Breeding

Interspecific hybridization is the most effective method for producing poplar clones for commercial applications, including biomass production. Previous research has shown that commercial F1 hybrids frequently exhibit dosage variation, i.e. variation in the number of pieces or entire chromosomes, and that these variants can have novel or more extreme phenotypes compared to their parents, that can be desirable for biomass production. Poplar is a convenient system for studying and exploiting gene dosage because germplasm can very easily be propagated vegetatively, via cuttings, for research and production, and advanced genome-enabled tools can be directly employed on the actual feedstock. In the previous funding cycle, we had produced and characterized a population of interspecific hybrids carrying insertions and deletions, which together, tile the entire genome with dosage variation. In this funding cycle, we completed the development of this unique resource for the research community and started using the germplasm to investigate the role of gene dosage in poplar hybrid performance, and to identify chromosomal regions and genes that contribute to poplar bioenergy traits. Our specific goals were to: i) maintain and finish the characterization of this resource ii) investigate the phenotypic effects of dosage change iii) exploit the indel germplasm for functional genomics.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Carbon-13 NMR spectra of lignin isolated from field grown transgenic poplar

Here we present a curated dataset of a series of 13C nuclear magnetic resonance (NMR) spectra of lignin isolated from transgenic monolignol 4-O-methyltransferase (MOMT4) engineered poplar. The transgenic poplar was collected from a 3-year field trial experiment. The poplar was Soxhlet-extracted with toluene/ethanol and the extractives-free poplar was then ball-milled in a Retsch PM100 planetary ball mill using a porcelain jar with ceramic balls at 600 rpm for 2 h. The ball-milled materials were then subjected to enzymatic hydrolysis for 48 h followed by centrifugation and washing with deionized water. The solid residue was extracted twice with 96:4 (v/v) 1,4-dioxane/water mixture at room temperature overnight. The extracts were combined, rotary evaporated, and freeze-dried to recover the lignin. The dry lignin samples were dissolved in deuterated dimethyl sulfoxide for NMR characterization. 13C experiments were performed in a Bruker Avance III HD 500 MHz NMR spectrometer operating at a frequency of 125.12 MHz for the 13C nucleus using a standard Bruker pulse sequence (zgpg) on a Prodigy platform cryoprobe. The NMR spectra were acquired under the following conditions: spectra width 229 ppm, 64k data points, 1s pulse delay, and 6k scans. All the data was processed using the Bruker’s TopSpin 3.6 software. Additional meta data is embedded in the raw spectra files.

13C NMR, lignin, poplar, field trial, MOMT4, CBI↗
DOE OSTI2023

Totally chlorine-free peracetic acid pulping for nanocellulose isolation from hemp and poplar

Nanocellulose is a promising and sustainable feedstock for developing advanced and functional materials. However, the characteristics of nanocellulose, such as crystallinity, surface energy, and aspect ratio, can vary depending on biomass source and pretreatment methods, leading to variable performance of the nanocellu-lose-based materials. In this study, cellulose nanocrystals (CNCs) were isolated from hemp and poplar using totally chlorine free (TCF) peracetic acid and sodium chlorite delignification and bleaching pretreatments to probe the influences of biomass source and treatment methods on the isolation and characteristics of CNCs. Our results showed that hemp and poplar were almost completely delignified by peracetic acid treatment, whereas sodium chlorite treatment left 5%–6% lignin in the pulp. The yields of CNCs from raw hemp and poplar biomass ranged from 9.8% to 21.9% and 10.9% to 28.3%, respectively, depending on the treatment methods. The dimensions of CNCs from TCF-treated biomass generally maintained a larger width and aspect ratio than those from sodium chlorite-treated biomass. The poplar-derived CNCs exhibited slightly higher crystallinity of 53%–58% than hemp-derived CNCs of 49%–54%. The zeta potential of the CNCs, ranging from -20.1 mV to -31.1 mV, ensured a well-dispersed aqueous solution. The surface energy (dispersive energy of 40–80 mJ/m2 and specific energy of 2–10 mJ/m2), water interaction, and thermal stability of the CNCs were comparable, regardless of the biomass source and pretreatment methods. Our finding suggests that the TCF technique with peracetic acid treatment is a promising delignification and bleaching approach to obtain cellulose-rich pulps from herbaceous and hardwood biomass for nanocellulose isolation.

09 BIOMASS FUELS↗
DOE OSTI2022

Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba)

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six s ynthetic d rought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis -regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Engineering Curcumin Biosynthesis in Poplar Affects Lignification and Biomass Yield

Lignocellulosic biomass is recalcitrant toward deconstruction into simple sugars mainly due to the presence of lignin. By engineering plants to partially replace traditional lignin monomers with alternative ones, lignin degradability and extractability can be enhanced. Previously, the alternative monomer curcumin has been successfully produced and incorporated into lignified cell walls of Arabidopsis by the heterologous expression of DIKETIDE-CoA SYNTHASE (DCS) and CURCUMIN SYNTHASE2 (CURS2). The resulting transgenic plants did not suffer from yield penalties and had an increased saccharification yield after alkaline pretreatment. Here, we translated this strategy into the bio-energy crop poplar. Via the heterologous expression of DCS and CURS2 under the control of the secondary cell wall CELLULOSE SYNTHASE A8-B promoter (ProCesA8-B), curcumin was also produced and incorporated into the lignified cell walls of poplar. ProCesA8-B:DCS_CURS2 transgenic poplars, however, suffered from shoot-tip necrosis and yield penalties. Compared to that of the wild-type (WT), the wood of transgenic poplars had 21% less cellulose, 28% more matrix polysaccharides, 23% more lignin and a significantly altered lignin composition. More specifically, ProCesA8-B:DCS_CURS2 lignin had a reduced syringyl/guaiacyl unit (S/G) ratio, an increased frequency of p-hydroxyphenyl (H) units, a decreased frequency of p-hydroxybenzoates and a higher fraction of phenylcoumaran units. Without, or with alkaline or hot water pretreatment, the saccharification efficiency of the transgenic lines was equal to that of the WT. These differences in (growth) phenotype illustrate that translational research in crops is essential to assess the value of an engineering strategy for applications. Further fine-tuning of this research strategy (e.g., by using more specific promoters or by translating this strategy to other crops such as maize) might lead to transgenic bio-energy crops with cell walls more amenable to deconstruction without settling in yield.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2019

Ecosystem services of poplar at long-term phytoremediation sites in the Midwest and Southeast, United States

Short rotation woody crops (SRWCs) including Populus species and their hybrids (i.e., poplars) are ideal for incorporating biomass production with phytotechnologies such as phytoremediation. To integrate these applications, 15 poplar plantings from nine long-term phytoremediation installations were sampled from 2012 to 2013 in the Midwest (Illinois, Iowa, Wisconsin) and Southeast (Alabama, Florida, North Carolina) United States. In this review, we report summary results of this sampling and how performance at each site compared with comparable phytoremediation systems in the literature. We review significant genotypic differences from each planting within the context of provisioning (i.e., biomass production) and regulating (i.e., carbon sequestration) ecosystem services and how they relate to the need for a cleaner environment during times of accelerated ecological degradation. Overall, the contaminated poplar sites provided these ecosystem services comparable to noncontaminated poplar sites used for bioenergy and biofuels feedstock production. For example, phytoremediation trees at the Midwestern sites had biomass values ranging from 4.4 to 15.5 Mg ha –1 y –1 , which was 20% less relative to bioenergy trees (p = .0938). Results were similar for diameter and carbon, with some genotype x environment interactions resulting in phytoremediation trees exhibiting substantially greater growth and productivity (i.e., +131% at one site). As illustrated in the current review, phytoremediation success can be increased with the identification and deployment of genotypes tailored to grow well and tolerate a broad diversity of contaminants (generalists) (i.e., 'DN34', 'NM6', '7300501') versus those that significantly outperform their counterparts under unique site conditions (specialists) (i.e., '220-5', '51-5', 'S13C20').

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2019

Quantitative fermentation of unpretreated transgenic poplar by Caldicellulosiruptor bescii

Microbial fermentation of lignocellulosic biomass to produce industrial chemicals is exacerbated by the recalcitrant network of lignin, cellulose and hemicelluloses comprising the plant secondary cell wall. In this study, we show that transgenic poplar (Populus trichocarpa) lines can be solubilized without any pretreatment by the extreme thermophile Caldicellulosiruptor bescii that has been metabolically engineered to shift its fermentation products away from inhibitory organic acids to ethanol. Carbohydrate solubilization and conversion of unpretreated milled biomass is nearly 90% for two transgenic lines, compared to only 25% for wild-type poplar. Unexpectedly, unpretreated intact poplar stems achieved nearly 70% of the fermentation production observed with milled poplar as the substrate. The nearly quantitative microbial conversion of the carbohydrate content of unpretreated transgenic lignocellulosic biomass bodes well for full utilization of renewable biomass feedstocks.

09 BIOMASS FUELS↗
DOE OSTI2025

Poplar: a phylogenomics pipeline

Motivation Generating phylogenomic trees from the genomic data is essential in understanding biological systems. Each step of this complex process has received extensive attention and has been significantly streamlined over the years. Given the public availability of data, obtaining genomes for a wide selection of species is straightforward. However, analyzing that data to generate a phylogenomic tree is a multistep process with legitimate scientific and technical challenges, often requiring a significant input from a domain-area scientist. Results We present Poplar, a new, streamlined computational pipeline, to address the computational logistical issues that arise when constructing the phylogenomic trees. It provides a framework that runs state-of-the-art software for essential steps in the phylogenomic pipeline, beginning from a genome with or without an annotation, and resulting in a species tree. Running Poplar requires no external databases. In the execution, it enables parallelism for execution for clusters and cloud computing. The trees generated by Poplar match closely with state-of-the-art published trees. The usage and performance of Poplar is far simpler and quicker than manually running a phylogenomic pipeline. Availability and implementation Freely available on GitHub at https://github.com/sandialabs/poplar. Implemented using Python and supported on Linux.

Koning, Elizabeth [Sandia National Laboratories (S↗