Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “Sequence”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 451 records · Page 25
All sourcesNASA NTRSDOE OSTI
NASA NTRS2017

Novel End-to-End Molecular Biology Approach for Direct Nanopore 1D cDNA Sequencing of Reverse Transcribed mRNAs Purified from Cell Cultures by the NASA ISS WetLab2 SPM

Continued space bioscience research onboard the International Space Station (ISS) and future long-duration flight missions to the Moon or Mars will require the ability to conduct on-orbit molecular analysis of biological samples independently from Earth. In the last year two new molecular analytic technologies have been installed and the technologies demonstrated onboard the ISS: The Sample Prep Module (SPM) WetLab-2 (WL2) qRT-PCR toolbox and the Oxford Nanopore MinIon Biomolecule Sequencer. Here we describe protocol development and integration into existing ISS technology for end-to-end on-orbit biological sample processing and molecular analysis with real time results generated utilizing only field offline analytic software. For this experiment we isolated primary cells from bone marrow flushes of wild type B6129SF2 mice (Jackson Labs) long bones. The cell isolate was then processed using the SPM to produce total 147nanograms of RNA. The total RNA was purified to only messenger RNA (mRNA) and transferred to Smartcycler Thermocycle ISS kit consumable tube using Eppendorf gel loading pipette tips for further processing. Complementary first strand cDNA was synthesized using OLIGO dT priming followed by addition of SuperScript II Reverse Transcriptase and thermal cycling as per manufacturers instruction. All thermal cycling was conducted using the ISS WetLab-2 Cephid Smarcycler real time thermal cycler. Our protocol takes advantage of mRNAs native poly(A) tail, synthesized in vivo to protect the mRNA from degradation by endonucleases, to eliminate end-prep for adapter ligation. The adapted library is purified using MyOne C1 Streptavidin beads before elution in buffer. The pre-sequencing library is diluted in the loading buffer and injected into the MinIon sample port, drawn into the nanopore window by capillary action, and sequenced using the MinKnown software with local basecalling. The sequencing read produced 34.5 million events and local basecalling produced 117,301 successful reads. NCBI Blast of the data for the mouse genome resulted in 2,462 successful nucleotide collection matches (gene sequences) exceeding 70 homology. These results demonstrate the viability of this novel flight ready end-to-end sample analytic methodology and provide a real time homolog for flight experimentation utilizing supply kits and technologies that have already been demonstrated on ISS.

MinIon↗
DOE OSTI2015

High-throughput analysis of T-DNA location and structure using sequence capture

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS2003

Iterative pass optimization of sequence data

The problem of determining the minimum-cost hypothetical ancestral sequences for a given cladogram is known to be NP-complete. This "tree alignment" problem has motivated the considerable effort placed in multiple sequence alignment procedures. Wheeler in 1996 proposed a heuristic method, direct optimization, to calculate cladogram costs without the intervention of multiple sequence alignment. This method, though more efficient in time and more effective in cladogram length than many alignment-based procedures, greedily optimizes nodes based on descendent information only. In their proposal of an exact multiple alignment solution, Sankoff et al. in 1976 described a heuristic procedure--the iterative improvement method--to create alignments at internal nodes by solving a series of median problems. The combination of a three-sequence direct optimization with iterative improvement and a branch-length-based cladogram cost procedure, provides an algorithm that frequently results in superior (i.e., lower) cladogram costs. This iterative pass optimization is both computation and memory intensive, but economies can be made to reduce this burden. An example in arthropod systematics is discussed. c2003 The Willi Hennig Society. Published by Elsevier Science (USA). All rights reserved.

NASA Discipline Evolutionary Biology↗
NASA NTRS1989

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

NASA Discipline Exobiology↗
NASA NTRS1991

The sequence of Methanospirillum hungatei 23S rRNA confirms the specific relationship between the extreme halophiles and the Methanomicrobiales

We have determined the sequence of the 23S rRNA from the methanogenic archaeon Methanospirillum hungatei. This is the first such sequence from a member of the Methanomicrobiales. Moreover, it brings additional evidence to bear on the possible specific relationship between this particular group of methanogens and the extreme halophiles. Such evidence is critical in that several new (and relatively untested) methods of phylogenetic inference have lead to the controversial conclusion that the extreme halophiles are either not related to the archaea, or are only peripherally so. Analysis of the Methanospirillum hungatei 23S rRNA sequence shows the Methanomicrobiales are indeed a sister group of the extreme halophiles, further strengthening the conclusions reached from analysis of 16S rRNA sequences.

Non-NASA Center↗
NASA NTRS1995

Sequence, molecular properties, and chromosomal mapping of mouse lumican

PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

NASA Discipline Cell Biology↗
NASA NTRS1992

Identification of a nuclear localization sequence in the polyomavirus capsid protein VP2

A nuclear localization signal (NLS) has been identified in the C-terminal (Glu307-Glu-Asp-Gly-Pro-Gln-Lys-Lys-Lys-Arg-Arg-Leu318) amino acid sequence of the polyomavirus minor capsid protein VP2. The importance of this amino acid sequence for nuclear transport of newly synthesized VP2 was demonstrated by a genetic "subtractive" study using the constructs pSG5VP2 (expressing full-length VP2) and pSG5 delta 3VP2 (expressing truncated VP2, lacking amino acids Glu307-Leu318). These constructs were transfected into COS-7 cells, and the intracellular localization of the VP2 protein was determined by indirect immunofluorescence. These studies revealed that the full-length VP2 was localized in the nucleus, while the truncated VP2 protein was localized in the cytoplasm and not transported to the nucleus. A biochemical "additive" approach was also used to determine whether this sequence could target nonnuclear proteins to the nucleus. A synthetic peptide identical to VP2 amino acids Glu307-Leu318 was cross-linked to the nonnuclear proteins bovine serum albumin (BSA) or immunoglobulin G (IgG). The conjugates were then labeled with fluorescein isothiocyanate and microinjected into the cytoplasm of NIH 3T6 cells. Both conjugates localized in the nucleus of the microinjected cells, whereas unconjugated BSA and IgG remained in the cytoplasm. Taken together, these genetic subtractive and biochemical additive approaches have identified the C-terminal sequence of polyoma-virus VP2 (containing amino acids Glu307-Leu318) as the NLS of this protein.

Non-NASA Center↗
DOE OSTI2019

Magnetic resonance elastography SE-EPI vs GRE sequences at 3T in a pediatric population with liver disease

Purpose: The goal of our study is to compare hepatic stiffness measures using gradient-recalled echo (GRE) versus spin-echo echo planar imaging (SE-EPI)-based MR Elastography (MRE) at 3T used to measure hepatic stiffness in a patients with suspected liver diseases. Materials and methods: This retrospective study included 52 patients with liver disease who underwent a 3T MRE exam including both an investigational SE-EPI-based technique and a product GRE-based technique. Regions of interest (ROI) were placed on the elastograms to measure elastography-derived liver stiffness as well as the area included within the ROIs. The mean liver stiffness values and area of ROIs were compared. Results: The mean liver stiffness was 3.72 kilopascal (kPa) ± 1.29 using GRE MRE and 3.78 kPa ± 1.13 using SE-EPI MRE. Measurement of liver stiffness showed excellent agreement between the two pulse sequences with a mean bias of − 0.1 kPa (range − 1.8 to 1.7 kPa) between sequences. The mean measurable ROI area was higher with SE-EPI (313.8 cm{sup 2} ± 213.8) than with the GRE technique (208.6 cm{sup 2} ± 114.8), and the difference was statistically significant (P < 0.05). Conclusions: Our data shows excellent agreement of measured liver stiffness between GRE and SE-EPI-based sequences at 3T. Our results show the advantage of a SE-EPI MRE sequence in terms of image quality, ROI size and acquisition time with equivalent liver stiffness measurements as compared to GRE-MRE sequence.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2017

Front-End Electron Transfer Dissociation Coupled to a 21 Tesla FT-ICR Mass Spectrometer for Intact Protein Sequence Analysis

High resolution mass spectrometry is a key technology for in-depth protein characterization. High-field Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) enables high-level interrogation of intact proteins in the most detail to date. However, an appropriate complement of fragmentation technologies must be paired with FTMS to provide comprehensive sequence coverage, as well as characterization of sequence variants, and post-translational modifications. Here we describe the integration of front-end electron transfer dissociation (FETD) with a custom-built 21 tesla FT-ICR mass spectrometer, which yields unprecedented sequence coverage for proteins ranging from 2.8 to 29 kDa, without the need for extensive spectral averaging (e.g., ~60% sequence coverage for apo-myoglobin with four averaged acquisitions). The system is equipped with a multipole storage device separate from the ETD reaction device, which allows accumulation of multiple ETD fragment ion fills. Consequently, an optimally large product ion population is accumulated prior to transfer to the ICR cell for mass analysis, which improves mass spectral signal-to-noise ratio, dynamic range, and scan rate. We find a linear relationship between protein molecular weight and minimum number of ETD reaction fills to achieve optimum sequence coverage, thereby enabling more efficient use of instrument data acquisition time. Finally, real-time scaling of the number of ETD reactions fills during method-based acquisition is shown, and the implications for LC-MS/MS top-down analysis are discussed. .

46 INSTRUMENTATION RELATED TO NUCLEAR SCIENCE AND ↗
DOE OSTI2024

A General Materials Data Science Framework for Quantitative 2D Analysis of Particle Growth from Image Sequences

Abstract Phase transformations are a challenging problem in materials science, which lead to changes in properties and may impact performance of material systems in various applications. We introduce a general framework for the analysis of particle growth kinetics by utilizing concepts from machine learning and graph theory. As a model system, we use image sequences of atomic force microscopy showing the crystallization of an amorphous fluoroelastomer film. To identify crystalline particles in an amorphous matrix and track the temporal evolution of the particle dispersion, we have developed quantitative methods of 2D analysis. 700 image sequences were analyzed using a neural network architecture, achieving 0.97 pixel-wise classification accuracy as a measure of the correctly classified pixels. The growth kinetics of isolated and impinged particles were tracked throughout time using these image sequences. The relationship between image sequences and spatiotemporal graph representations was explored to identify the proximity of crystallites from each other. The framework enables the analysis of all image sequences without the requirement of sampling for specific particles or timesteps for various materials systems.

36 MATERIALS SCIENCE↗
DOE OSTI2018

Weak and strong orders of linear recurring sequences

The concept of the strong order of linear recurring sequence (LRS) is introduced in this paper. Necessary and sufficient conditions for the existence of the strong LRS order are derived. The strong LRS order is exploited for the formalization of the problem of the extension of a sequence from the available fragment (fragments) of that sequence. The definition of the strong LRS order opens new possibilities for formal sequence analysis whenever the weak LRS order of that sequence exists. Computational experiments with discrete iterative maps are used to illustrate the applicability of the strong LRS order in nonlinear system analysis.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2014

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2017

Sequences in Linker-1 domain of the multidrug resistance associated protein (MRP1 or ABCC1) bind to tubulin and their binding is modulated by phosphorylation

The multidrug resistant associated protein 1 (or MRP1, ABCC1) encodes two cytoplasmic linker domains (L0 and L1) composed of highly charged sequences with multiple protein kinase A/C phosphorylation sites. In this report we made use of the scanning peptide approach to identify MRP1 linker L1 (L1{sup MRP1}) interacting proteins. Scanning heptapeptides covering L1{sup MRP1} 126 amino acids (Ile{sup 846}- Leu{sup 972}) were synthesized and used in pull-down assays to isolate proteins from cell extracts (human multidrug resistant SCLC cell line; H69/AR). The results show four high affinity binding sequences in L1{sup MRP1} domain [{sup 866}FLRTYAST{sup 867}; {sup 906}SAGKQLQRQLSSS{sup 912}; {sup 925}ISRHHNSTA{sup 927} and {sup 954}AQTGQVKLSVYW{sup 959}] that bound ∼55 kDa and 110 kDa polypeptides. The latter polypeptides were identified by mass spectrometry as α- and β-tubulin monomers and dimers. Western blotting with monoclonal antibodies to α- and β-tubulin proteins confirmed the mass-spectrometry results. Moreover, using recombinant full-length GST-Linker 1 fusion polypeptide (GST-L1{sup MRP1}), we confirmed the peptide scanning approach demonstrating specific binding of tubulin to GST-L1{sup MRP1}. Intriguingly, substitutions of serine residues in L1{sup MRP1} by aspartic acid, but not alanine, abolished its binding to tubulin, suggesting that phosphorylation of Ser{sup 871,} {sup 915,} {sup 930,} {sup and} {sup 961} within L1{sup MRP1} may modulate its binding to tubulin. Taken together, the results of this study suggest possible interaction between MRP1 and tubulin that is modulated by phosphorylation of specific sequences in the L1{sup MRP1} domain. - Highlights: • This study shows direct binding between MRP1 Linker 1 (L1{sup MRP1}) domain and α- and β-tubulin subunits, using a scanning peptide approach. • Four short and dispersed sequences in L1{sup MRP1} domain interact with α/β-tubulin subunits. • Each sequence in L1{sup MRP1}-tubulin binding domain contains predicted protein kinase C/A site. • Substituting 3 of 4 serine with aspartic acid, but not alanine, in L1{sup MRP1} binding domains inhibit their binding to tubulin subunits.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2021

Machine learning reveals sequence-function relationships in family 7 glycoside hydrolases

Family 7 glycoside hydrolases (GH7) are among the principal enzymes for cellulose degradation in nature and industrially. These important enzymes are often bimodular, including a catalytic domain and carbohydrate binding module (CBM) attached via a flexible linker, and exhibit an active site that binds cello-oligomers of up to ten glucosyl moieties. GH7 cellulases consist of two major subtypes: cellobiohydrolases (CBH) and endoglucanases (EG). Despite the critical importance of GH7 enzymes, there remain gaps in our understanding of how GH7 sequence and structure relate to function. Here, we employed machine learning to gain data-driven insights into relationships between sequence, structure, and function across the GH7 family. Machine-learning models, trained only on the number of residues in the active-site loops as features, were able discriminate GH7 CBHs and EGs with up to 99% accuracy, demonstrating that the lengths of loops A4, B2, B3, and B4 strongly correlate with functional subtype across the GH7 family. Classification rules were derived such that specific residues at 42 different sequence positions each predicted the functional subtype with accuracies surpassing 87%. A random forest model trained on residues at 19 positions in the catalytic domain predicted the presence of a CBM with 89.5% accuracy. Our ML results recapitulate, as top-performing features, a substantial number of the sequence positions determined by previous experimental studies to play vital roles in GH7 activity. We surmise that the yet-to-be-explored sequence positions among the top-performing features also contribute to GH7 functional variation and may be exploited to understand and manipulate function.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2015

Increasing Sequence Diversity with Flexible Backbone Protein Design: The Complete Redesign of a Protein Hydrophobic Core

Protein design tests our understanding of protein stability and structure. Successful design methods should allow the exploration of sequence space not found in nature. However, when redesigning naturally occurring protein structures, most fixed backbone design algorithms return amino acid sequences that share strong sequence identity with wild-type sequences, especially in the protein core. This behavior places a restriction on functional space that can be explored and is not consistent with observations from nature, where sequences of low identity have similar structures. Here, we allow backbone flexibility during design to mutate every position in the core (38 residues) of a four-helix bundle protein. Only small perturbations to the backbone, 12 {angstrom}, were needed to entirely mutate the core. The redesigned protein, DRNN, is exceptionally stable (melting point >140C). An NMR and X-ray crystal structure show that the side chains and backbone were accurately modeled (all-atom RMSD = 1.3 {angstrom}).

Murphy, Grant S.↗
DOE OSTI2016

Sequence polymorphism in an insect RNA virus field population: A snapshot from a single point in space and time reveals stochastic differences among and within individual hosts

Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of the corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2023

Using low-coverage whole genome sequencing (genome skimming) to delineate three introgressed species of buffalofish ( Ictiobus )

Consumption of buffalofish has been sporadically associated with Haff disease-like illnesses involving sudden onset muscle pain and weakness due to skeletal muscle rhabdomyolysis, but determination of precisely which species are associated with these illnesses has been impeded by a lack of species-specific DNA-based markers. Here, three closely related species of buffalofish native to the Mississippi River Basin (Ictiobus bubalus, Ictiobus cyprinellus and Ictiobus niger) that have previously proven genetically indistinguishable using both mitochondrial and nuclear single-locus sequencing were reliably discriminated using low-coverage whole genome sequencing (‘genome skimming’). Using 44 specimens representing the three species collected from the mid/upper (Missouri) and lower (Louisiana) regions of the species’ native ranges, the SISRS (Site Identification from Short Read Sequences) bioinformatics pipeline was adapted to (1) identify over 620Mbp of putatively homologous nuclear sequence data and (2) isolate over 140,000 single-nucleotide polymorphisms (SNPs) that supported accurate species delimitation, all without the use of a reference genome or annotation data. These sites were used to classify Ictiobus spp. samples with genome-skim data, along with a larger set (n = 67) where ultraconserved elements (UCEs) were sequenced. Analyses of whole mitochondrial data revealed more limited signal. Nearly all samples matched their purported species based on morphologic identification, but two Missouri samples morphologically identified as I. niger grouped with samples of I. bubalus, albeit with significant enrichment of I. niger SNPs. To our knowledge this is the first report of a DNA-based tool to reliably discriminate these three morphologically distinct species.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Rational Design of Novel Biomimetic Sequence-Defined Polymers for Mineralization Applications

Silica biomineralization is a naturally occurring process, wherein organisms use proteins and other biological structures to direct the formation of complex, hierarchical nanostructures. Discovery and characterization of such proteins and their underlying mechanisms spurred significant efforts to identify routes for biomimetic mineralization that reproduce the exquisite shapes and size selectivities found in nature. A common strategy has been the use of short peptide sequences with chemistry mimicking those found in natural systems, such as the use of the silaffin-derived R5 peptide. While progress has been made using this approach, there are many limitations that have prevented breakthroughs in biomimicry. To advance our ability to use charged macromolecules for silica formation, we propose to use sequence-defined synthetic polymers known as peptoids, or N-substituted polyglycines, which present significant capability for the precise tuning of sequence and structure beyond what can often be achieved with peptides alone. This study presents a computationally predicted design of these polymers that leads to the controlled formation of silica nanomaterials. We investigate surface adsorption and the mineralization process through analysis of binding mechanisms and energetics of the R5 system. Next, we synthesized two R5-inspired peptoids and validated our prediction in the design of mineralization polymers through characterization using surface plasmon resonance and electron microscopy. Here, this computationally guided study holds great promise for designing new sequences with unprecedented control of the placement of chemical functional groups, thus allowing for further unraveling of silicification mechanisms and the eventual design of sequence-defined synthetic polymers leading to the predictive synthesis of nanostructured functional materials.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗