Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “DNA sequencing”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 433 records · Page 24
All sourcesNASA NTRSDOE OSTI
DOE OSTI2025

Old Woman Creek Wetland Sediment and Electrochemical Sensor Microbial Community, 2023

We are developing a technique to monitor microbiological activities referred to as zero resistance ammetry, which entails the deployment of graphite electrodes in sediments. Measurement of current between electrodes of contrasting redox regimes and/or predominant terminal electron accepting processes can be used as an indicator of the extents of microbiological activity. We deployed an electrode array at depths of 2 mm, 4 mm, 76 mm, 78 mm, 152 mm, 154 mm, 227 mm, and 229 mm below the wetland sediment water interface in the Old Woman Creek National Estuarine Research Center, Huron, OH, USA (Lat. = 41.380833, Long. = -82.508889). A core was collected from adjacent sediment and subsamples were collected from depth intervals of 0 – 25 mm, 25 – 127 mm, 127 – 128 mm, and below 178 mm. To determine if the microbial communities attached to the electrodes were reflective of the adjacent sediment-associated microbial community, we conducted a 16S rRNA gene-based (V4 region) survey of these respective materials. This data package contains the results of these surveys, including metadata on the depths from which samples were collected (samples.csv), DNA extraction and sequencing information (OWC_DEPTH_AMPLICON_SEQUENCING_METADATA), sequence processing information (OWC_DEPTH_BIOINFORMATIC_METADATA.csv), an operational taxonomic unit (OTU) table (OWC_DEPTH_97OTUS_TABLE.csv), and nucleotide sequences of OTUs (OWC_DEPTH_97OTUS_SEQS.fasta). All files can be opened using a text-editing application. The fasta file is compatible with bioinformatics applications.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2020

Predicting Drug Resistance Using Deep Mutational Scanning

Drug resistance is a major healthcare challenge, resulting in a continuous need to develop new inhibitors. The development of these inhibitors requires an understanding of the mechanisms of resistance for a critical mass of occurrences. Recent genome editing technologies based on high-throughput DNA synthesis and sequencing may help to predict mutations resulting in resistance by testing large mutagenesis libraries. Here we describe the rationale of this approach, with examples and relevance to drug development and resistance in malaria.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS1983

Immobilization/remobilization and the regulation of muscle mass

The relationship between animal body weight and the wet and dry weights of the soleus and EDL muscles was derived. Procedures were examined for tissue homogenization, fractionation, protein determination and DNA determination. A sequence of procedures and buffers were developed to carry out all analyses on one small muscle. This would yield a considerable increase in analytical strength associated with paired statistics. The proposed casting procedure which was to be used for immobilization was reexamined.

Almon, R. R.↗
NASA NTRS2002

From Field to Laboratory: A New Database Approach for Linking Microbial Field Ecology with Laboratory Studies

The Ames Exobiology Culture Collection Database (AECC-DB) has been developed as a collaboration between microbial ecologists and information technology specialists. It allows for extensive web-based archiving of information regarding field samples to document microbial co-habitation of specific ecosystem micro-environments. Documentation and archiving continues as pure cultures are isolated, metabolic properties determined, and DNA extracted and sequenced. In this way metabolic properties and molecular sequences are clearly linked back to specific isolates and the location of those microbes in the ecosystem of origin. Use of this database system presents a significant advancement over traditional bookkeeping wherein there is generally little or no information regarding the environments from which microorganisms were isolated. Generally there is only a general ecosystem designation (i.e., hot-spring). However within each of these there are a myriad of microenvironments with very different properties and determining exactly where (which microenvironment) a given microbe comes from is critical in designing appropriate isolation media and interpreting physiological properties. We are currently using the database to aid in the isolation of a large number of cyanobacterial species and will present results by PI's and students demonstrating the utility of this new approach.

Bebout, Leslie↗
NASA NTRSDate not supplied

Determining Chlamydomonas reinhardtii resistance to ionizing radiation at a genome-wide scale

Spaceflight is a complex mixture of abiotic stresses that causes a myriad of cellular responses including increased genome-wide mutation load. The impact of spaceflight on mutation load is not well understood for most organisms and is especially critical to characterize for candidate microorganisms that could be part of biological life support systems. Prior research in our laboratory revealed an unexpectedly high level of mutation during spaceflight in the eukaryotic green algae, C. reinhardtii. Based on the spectrum of base changes observed, we concluded that the mutations were generated through a molecular mechanism unique to the spaceflight environment. Spaceflight is a complex set of stresses, and we are using an Earth-based analog to test ionizing radiation as a potential causative variable for the unique mutation spectrum observed in spaceflight. C. reinhardtii was grown exposed to chronic radiation from a Cesium-137 source. Four biological replicate cultures of wild-type cells were grown in gas permeable plastic tissue culture bags in liquid media following the design used on the International Space Station (ISS) during the previous space algae experiment. Radiation levels for this experiment approximate ionizing radiation observed on the moon, in low Earth orbit (LEO), and on Earth. Cells from each replicate were passaged to inoculate the next cycle of growth, then samples were taken from each culture to characterize cell morphology, quantify biomass, and extract DNA. Whole genome sequencing from each culture will be used to identify the frequency and types of mutations in each radiation level. In growth cycles 3 and 4, there was a significant increase in biomass accumulation under lunar radiation level compared to LEO or Earth radiation levels. These results such that ionizing radiation affected growth of C. reinhardtii.

Microbiology↗
NASA NTRSDate not supplied

Determining Chlamydomonas Reinhardtii Resistance to Ionizing Radiation at A Genome-Wide Scale

Spaceflight is a complex mixture of abiotic stresses that causes a myriad of cellular responses including increased genome-wide mutation load. The impact of spaceflight on mutation load is not well understood for most organisms and is especially critical to characterize for candidate microorganisms that could be part of biological life support systems. Prior research in our laboratory revealed an unexpectedly high level of mutation during spaceflight in the eukaryotic green algae, C. reinhardtii. Based on the spectrum of base changes observed, we concluded that the mutations were generated through a molecular mechanism unique to the spaceflight environment. Spaceflight is a complex set of stresses, and we are using an Earth-based analog to test ionizing radiation as a potential causative variable for the unique mutation spectrum observed in spaceflight. C. reinhardtii was grown exposed to chronic radiation from a Cesium-137 source. Four biological replicate cultures of wild-type cells were grown in gas permeable plastic tissue culture bags in liquid media following the design used on the International Space Station (ISS) during the previous space algae experiment. Radiation levels for this experiment approximate ionizing radiation observed on the moon, in low Earth orbit (LEO), and on Earth. Cells from each replicate were passaged to inoculate the next cycle of growth, then samples were taken from each culture to characterize cell morphology, quantify biomass, and extract DNA. Whole genome sequencing from each culture will be used to identify the frequency and types of mutations in each radiation level. In growth cycles 3 and 4, there was a significant increase in biomass accumulation under lunar radiation level compared to LEO or Earth radiation levels. These results show that ionizing radiation affected growth of C. reinhardtii.

Hope Hersh↗
NASA NTRS2003

Bacillus nealsonii sp. nov., isolated from a spacecraft-assembly facility, whose spores are gamma-radiation resistant

One of the spore-formers isolated from a spacecraft-assembly facility, belonging to the genus Bacillus, is described on the basis of phenotypic characterization, 16S rDNA sequence analysis and DNA-DNA hybridization studies. It is a Gram-positive, facultatively anaerobic, rod-shaped eubacterium that produces endospores. The spores of this novel bacterial species exhibited resistance to UV, gamma-radiation, H2O2 and desiccation. The 18S rDNA sequence analysis revealed a clear affiliation between this strain and members of the low G+C Firmicutes. High 16S rDNA sequence similarity values were found with members of the genus Bacillus and this was supported by fatty acid profiles. The 16S rDNA sequence similarity between strain FO-92T and Bacillus benzoevorans DSM 5391T was very high. However, molecular characterizations employing small-subunit 16S rDNA sequences were at the limits of resolution for the differentiation of species in this genus, but DNA-DNA hybridization data support the proposal of FO-92T as Bacillus nealsonii sp. nov. (type strain is FO-92T =ATCC BAAM-519T =DSM 15077T).

Non-programmatic↗
DOE OSTI2023

Double DAP-seq uncovered synergistic DNA binding of interacting bZIP transcription factors

Many eukaryotic transcription factors (TF) form homodimer or heterodimer complexes to regulate gene expression. Dimerization of BASIC LEUCINE ZIPPER (bZIP) TFs are critical for their functions, but the molecular mechanism underlying the DNA binding and functional specificity of homo- versus heterodimers remains elusive. To address this gap, we present the double DNA Affinity Purification-sequencing (dDAP-seq) technique that maps heterodimer binding sites on endogenous genomic DNA. Using dDAP-seq we profile twenty pairs of C/S1 bZIP heterodimers and S1 homodimers in Arabidopsis and show that heterodimerization significantly expands the DNA binding preferences of these TFs. Analysis of dDAP-seq binding sites reveals the function of bZIP9 in abscisic acid response and the role of bZIP53 heterodimer-specific binding in seed maturation. The C/S1 heterodimers show distinct preferences for the ACGT elements recognized by plant bZIPs and motifs resembling the yeast GCN4 cis -elements. This study demonstrates the potential of dDAP-seq in deciphering the DNA binding specificities of interacting TFs that are key for combinatorial gene regulation.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS1994

Emergence of a replicating species from an in vitro RNA evolution reaction

The technique of self-sustained sequence replication allows isothermal amplification of DNA and RNA molecules in vitro. This method relies on the activities of a reverse transcriptase and a DNA-dependent RNA polymerase to amplify specific nucleic acid sequences. We have modified this protocol to allow selective amplification of RNAs that catalyze a particular chemical reaction. During an in vitro RNA evolution experiment employing this modified system, a unique class of "selfish" RNAs emerged and replicated to the exclusion of the intended RNAs. Members of this class of selfish molecules, termed RNA Z, amplify efficiently despite their inability to catalyze the target chemical reaction. Their amplification requires the action of both reverse transcriptase and RNA polymerase and involves the synthesis of both DNA and RNA replication intermediates. The proposed amplification mechanism for RNA Z involves the formation of a DNA hairpin that functions as a template for transcription by RNA polymerase. This arrangement links the two strands of the DNA, resulting in the production of RNA transcripts that contain an embedded RNA polymerase promoter sequence.

Non-NASA Center↗
DOE OSTI2021

Conformational Changes of RORγ During Response Element Recognition and Coregulator Engagement

The retinoic acid receptor-related orphan receptor γ (RORγ) is a ligand-dependent transcription factor of the nuclear receptor super family that underpins metabolic activity, immune function, and cancer progression. Despite being a valuable drug target in health and disease, our understanding of the ligand-dependent activities of RORγ is far from complete. Like most nuclear receptors, RORγ must recruit coregulatory protein to enact the RORγ target gene program. To date, a majority of structural studies have been focused exclusively on the RORγ ligand-binding domain and the ligand-dependent recruitment of small peptide segments of coregulators. Herein, we examine the ligand-dependent assembly of full length RORγ:coregulator complexes on cognate DNA response elements using structural proteomics and small angle x-ray scattering. The results from our studies suggest that RORγ becomes elongated upon DNA recognition, preventing long range interdomain crosstalk. We also determined that the DNA binding domain adopts a sequence-specific conformation, and that coregulatory protein may be able to ‘sense’ the ligand- and DNA-bound status of RORγ. We propose a model where ligand-dependent coregulator recruitment may be influenced by the sequence of the DNA to which RORγ is bound. Overall, the efforts described herein will illuminate important aspects of full length RORγ and monomeric orphan nuclear receptor target gene regulation through DNA-dependent conformational changes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Allosteric autoregulation of DNA binding via a DNA-mimicking protein domain: a biophysical study of ZNF410–DNA interaction using small angle X-ray scattering

ZNF410 is a highly-conserved transcription factor, remarkable in that it recognizes a 15-base pair DNA element but has just a single responsive target gene in mammalian erythroid cells. ZNF410 includes a tandem array of five zinc-fingers (ZFs), surrounded by uncharacterized N- and C-terminal regions. Unexpectedly, full-length ZNF410 has reduced DNA binding affinity, compared to that of the isolated DNA binding ZF array, both in vitro and in cells. AlphaFold predicts a partially-folded N-terminal subdomain that includes a 30-residue long helix, preceded by a hairpin loop rich in acidic (aspartate/glutamate) and serine/threonine residues. This hairpin loop is predicted by AlphaFold to lie against the DNA binding interface of the ZF array. In solution, ZNF410 is a monomer and binds to DNA with 1:1 stoichiometry. Surprisingly, the single best-fit model for the experimental small angle X-ray scattering profile, in the absence of DNA, is the original AlphaFold model with the N-terminal long-helix and the hairpin loop occupying the ZF DNA binding surface. For DNA binding, the hairpin loop presumably must be displaced. After combining biophysical, biochemical, bioinformatic and artificial intelligence-based AlphaFold analyses, we suggest that the hairpin loop mimics the structure and electrostatics of DNA, and provides an additional mechanism, supplementary to sequence specificity, of regulating ZNF410 DNA binding.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS2004

Variation in sulfide tolerance of photosystem II in phylogenetically diverse cyanobacteria from sulfidic habitats

Physiological and molecular phylogenetic approaches were used to investigate variation among 12 cyanobacterial strains in their tolerance of sulfide, an inhibitor of oxygenic photosynthesis. Cyanobacteria from sulfidic habitats were found to be phylogenetically diverse and exhibited an approximately 50-fold variation in photosystem II performance in the presence of sulfide. Whereas the degree of tolerance was positively correlated with sulfide levels in the environment, a strain's phenotype could not be predicted from the tolerance of its closest relatives. These observations suggest that sulfide tolerance is a dynamic trait primarily shaped by environmental variation. Despite differences in absolute tolerance, similarities among strains in the effects of sulfide on chlorophyll fluorescence induction indicated a common mode of toxicity. Based on similarities with treatments known to disrupt the oxygen-evolving complex, it was concluded that sulfide toxicity resulted from inhibition of the donor side of photosystem II.

Phylogeny↗
NASA NTRS2002

The Arabidopsis SKU5 gene encodes an extracellular glycosyl phosphatidylinositol-anchored glycoprotein involved in directional root growth

To investigate how roots respond to directional cues, we characterized a T-DNA-tagged Arabidopsis mutant named sku5 in which the roots skewed and looped away from the normal downward direction of growth on inclined agar surfaces. sku5 roots and etiolated hypocotyls were slightly shorter than normal and exhibited a counterclockwise (left-handed) axial rotation bias. The surface-dependent skewing phenotype disappeared when the roots penetrated the agar surface, but the axial rotation defect persisted, revealing that these two directional growth processes are separable. The SKU5 gene belongs to a 19-member gene family designated SKS (SKU5 Similar) that is related structurally to the multiple-copper oxidases ascorbate oxidase and laccase. However, the SKS proteins lack several of the conserved copper binding motifs characteristic of copper oxidases, and no enzymatic function could be assigned to the SKU5 protein. Analysis of plants expressing SKU5 reporter constructs and protein gel blot analysis showed that SKU5 was expressed most strongly in expanding tissues. SKU5 was glycosylated and modified by glycosyl phosphatidylinositol and localized to both the plasma membrane and the cell wall. Our observations suggest that SKU5 affects two directional growth processes, possibly by participating in cell wall expansion.

NASA Discipline Plant Biology↗
NASA NTRS1999

Determination of human DNA polymerase utilization for the repair of a model ionizing radiation-induced DNA strand break lesion in a defined vector substrate

Human DNA polymerase and DNA ligase utilization for the repair of a major class of ionizing radiation-induced DNA lesion [DNA single-strand breaks containing 3'-phosphoglycolate (3'-PG)] was examined using a novel, chemically defined vector substrate containing a single, site-specific 3'-PG single-strand break lesion. In addition, the major human AP endonuclease, HAP1 (also known as APE1, APEX, Ref-1), was tested to determine if it was involved in initiating repair of 3'-PG-containing single-strand break lesions. DNA polymerase beta was found to be the primary polymerase responsible for nucleotide incorporation at the lesion site following excision of the 3'-PG blocking group. However, DNA polymerase delta/straightepsilon was also capable of nucleotide incorporation at the lesion site following 3'-PG excision. In addition, repair reactions catalyzed by DNA polymerase beta were found to be most effective in the presence of DNA ligase III, while those catalyzed by DNA polymerase delta/straightepsilon appeared to be more effective in the presence of DNA ligase I. Also, it was demonstrated that the repair initiating 3'-PG excision reaction was not dependent upon HAP1 activity, as judged by inhibition of HAP1 with neutralizing HAP1-specific polyclonal antibody.

Non-NASA Center↗
DOE OSTI2025

Unveiling a pervasive DNA adenine methylation regulatory network in the early-diverging fungus Rhizopus microsporus

Development of the DNA affinity purification and sequencing (DAP-seq) technique has allowed genome-scale studies of transcription factor (TF)-binding sites with high reproducibility. Here, we apply this technique to the human opportunistic pathogen Rhizopus microsporus, a mucoralean fungus belonging to the understudied group of early-diverging fungi. We characterize genome-wide binding sites of 58 TFs encoded by genes regulated through adenine methylation and representing major TF families. This analysis reveals their binding profiles and recognized sequences, expanding and diversifying the catalog of known fungal motifs. By integrating this data with DNA 6-methyladenine profiling, we uncover the extensive direct and indirect impact of this epigenetic modification on the regulation of gene expression. Furthermore, we use the generated data to identify TFs involved in biologically relevant processes such as zinc metabolism and light response. Our work enhances our understanding of regulatory mechanisms in R. microsporus and provides broader insights into gene regulation across the fungal kingdom.

Lax, Carlos [Universidad de Murcia (Spain)] (ORCID↗
NASA NTRS1999

Syntrophus aciditrophicus sp. nov., a new anaerobic bacterium that degrades fatty acids and benzoate in syntrophic association with hydrogen-using microorganisms

Strain SBT is a new, strictly anaerobic, gram-negative, nonmotile, non-sporeforming, rod-shaped bacterium that degrades benzoate and certain fatty acids in syntrophic association with hydrogen/formate-using microorganisms. Strain SBT produced approximately 3 mol of acetate and 0.6 mol of methane per mol of benzoate in coculture with Methanospirillum hungatei strain JF1. Saturated fatty acids, some unsaturated fatty acids, and methyl esters of butyrate and hexanoate also supported growth of strain SBT in coculture with Desulfovibrio strain G11. Strain SBT grew in pure culture with crotonate, producing acetate, butyrate, caproate, and hydrogen. The molar growth yield was 17 +/- 1 g cell dry mass per mol of crotonate. Strain SBT did not grow with fumarate, iron(III), polysulfide, or oxyanions of sulfur or nitrogen as electron acceptors with benzoate as the electron donor. The DNA base composition of strain SBT was 43.1 mol% G+C. Analysis of the 16 S rRNA gene sequence placed strain SBT in the delta-subdivision of the Proteobacteria, with sulfate-reducing bacteria. Strain SBT was most closely related to members of the genus Syntrophus. The clear phenotypic and genotypic differences between strain SBT and the two described species in the genus Syntrophus justify the formation of a new species, Syntrophus aciditrophicus.

Non-NASA Center↗