Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “Expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 379 records · Page 21
All sourcesNASA NTRSDOE OSTI
DOE OSTI2022

Expression of divergent methyl/alkyl coenzyme M reductases from uncultured archaea

Abstract Methanogens and anaerobic methane-oxidizing archaea (ANME) are important players in the global carbon cycle. Methyl-coenzyme M reductase (MCR) is a key enzyme in methane metabolism, catalyzing the last step in methanogenesis and the first step in anaerobic methane oxidation. Divergent mcr and mcr -like genes have recently been identified in uncultured archaeal lineages. However, the assembly and biochemistry of MCRs from uncultured archaea remain largely unknown. Here we present an approach to study MCRs from uncultured archaea by heterologous expression in a methanogen, Methanococcus maripaludis . Promoter, operon structure, and temperature were important determinants for MCR production. Both recombinant methanococcal and ANME-2 MCR assembled with the host MCR forming hybrid complexes, whereas tested ANME-1 MCR and ethyl-coenzyme M reductase only formed homogenous complexes. Together with structural modeling, this suggests that ANME-2 and methanogen MCRs are structurally similar and their reaction directions are likely regulated by thermodynamics rather than intrinsic structural differences.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Expression of interfacial Seebeck coefficient through grain boundary engineering with multi-layer graphene nanoplatelets

Energy filtering has been a long-sought strategy to enhance a thermoelectric material's figure of merit zT through improving its power factor. Here we show a composite of multi-layer graphene nanoplatelets (GNP) and n-type Mg 3 Sb 2 leads to the expression of an energy filtering like effect demonstrated by an increase in the material's Seebeck coefficient and maximum power factor, without impact on the material's carrier concentration. We analyse these findings from the perspective of a heterogeneous material consisting of grain and grain boundary phases, instead of a more traditional and common analysis that assumes a homogeneously transporting medium. An important implication of this treatment is that it leads to the development of an interfacial Seebeck coefficient term, which can explain the observed increase in the material's Seebeck coefficient. The contribution of this interfacial Seebeck coefficient to the overall Seebeck coefficient is determined by the relative temperature drop across the grain boundary region compared to that of the bulk material. In Te doped Mg 3 Sb 2 we show the introduction of GNP increases the interfacial thermal resistance of grain boundaries, enhancing the contribution of the interfacial Seebeck coefficient arising from grain boundaries to the overall Seebeck coefficient. Without significant detriment to the electrical conductivity this effect results in a net increase in maximum power factor. This increased interfacial thermal resistance also leads to the synergistic reduction of the total thermal conductivity. As a result, we enhance zT of the Mg 3 Sb 2 to a peak value of 1.7 near 750 K. Considering the two-dimensional nature of the grain boundary interface, this grain boundary engineering strategy could be applied to a few thermoelectric systems utilizing various two-dimensional nanomaterials.

42 ENGINEERING↗
DOE OSTI2021

Widespread polycistronic gene expression in green algae

Significance Historically, it has been understood that for gene expression in eukaryotes, each messenger RNA encodes a single protein. With the recent development of technologies to sequence full-length transcripts en masse, we have discovered hundreds of examples in two species of green algae where two, three, or more proteins are translated from a single transcript. These “polycistronic” transcripts are found in diverse species throughout the green algal lineage, which highlights their biological importance. We have leveraged these findings to coexpress pairs of genes on polycistronic transcripts in vitro, which should facilitate efforts to engineer algae for research and industrial applications.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Closed-form expressions for unitaries of spin-adapted fermionic operators

One of the open challenges in quantum computing simulations of problems of chemical interest is the proper enforcement of spin symmetry. Efficient quantum circuits implementing unitaries generated by spin-adapted operators remain elusive, while naïve Trotterization schemes break spin symmetry. Here, in this work, we analyze the mathematical structure of spin-adapted operators and derive closed-form expressions for unitaries generated by singlet spin-adapted generalised single and double excitations. These results represent significant progress toward the economical enforcement of spin symmetry in quantum simulations.

fermionic algebra↗
DOE OSTI2021

Viability, behavior, and color expression in the offspring of matings between common wall lizard Podarcis muralis color morphs

Abstract Color polymorphisms are widely studied to identify the mechanisms responsible for the origin and maintenance of phenotypic variability in nature. Two of the mechanisms of balancing selection currently thought to explain the long-term persistence of polymorphisms are the evolution of alternative phenotypic optima through correlational selection on suites of traits including color and heterosis. Both of these mechanisms can generate differences in offspring viability and fitness arising from different morph combinations. Here, we examined the effect of parental morph combination on fertilization success, embryonic viability, newborn quality, antipredator, and foraging behavior, as well as inter-annual survival by conducting controlled matings in a polymorphic lacertid Podarcis muralis, where color morphs are frequently assumed to reflect alternative phenotypic optima (e.g., alternative reproductive strategies). Juveniles were kept in outdoor tubs for a year in order to study inter-annual growth, survival, and morph inheritance. In agreement with a previous genome-wide association analysis, morph frequencies in the year-old juveniles matched the frequencies expected if orange and yellow expressions depended on recessive homozygosity at 2 separate loci. Our findings also agree with previous literature reporting higher reproductive output of heavy females and the higher overall viability of heavy newborn lizards, but we found no evidence for the existence of alternative breeding investment strategies in female morphs, or morph-combination effects on offspring viability and behavior. We conclude that inter-morph breeding remains entirely viable and genetic incompatibilities are of little significance for the maintenance of discrete color morphs in P. muralis from the Pyrenees.

Abalos, Javier↗
DOE OSTI2025

Metallothionein expression in Eastern mosquitofish ( Gambusia holbrooki ) exposed to 137 Cs and lead: implications for using metallothionein as a metal exposure biomarker

Given the range of threats facing aquatic ecosystems, it is critical we have monitoring tools to quickly and efficiently identify stressors within ecosystems. Metallothionein’s (MTs) are a group of proteins widely used as biomarkers of metal exposure; however, their suitability has been questioned due to their influenceable nature and ability to be induced by various stressors. Through our study, we sought to (1) evaluate induction of MT in eastern mosquitofish (Gambusia holbrooki) exposed to a radionuclide ( 137 Cs) and metal (Pb), (2) assess the influence of in situ 137 Cs pre-exposure on Pb-induced MT expression, and (3) quantify changes in MT concentrations during Pb depuration. We conducted our experiment in three phases using mosquitofish as a model species: Phase I—pre-exposure to 137 Cs in the field, Phase II—exposure to Pb in the lab immediately following 137 Cs exposure, and Phase III—depuration in the laboratory. We quantified MT concentrations over time and assessed differences among treatments. We did not find in situ exposure of mosquitofish to 137 Cs to induce MT, nor did pre-exposure to 137 Cs appear to influence induction of MT following Pb exposure. Metallothionein was rapidly induced in mosquitofish following Pb exposure; however, MT induction was also observed in control fish. Additionally, there was no apparent relationship between MT and Pb body burdens. During depuration, we found MT concentrations to be highly variable among fish demonstrating no clear response. Furthermore, our study demonstrates the high variability exhibited by MT, the need for further validation of MT as a metal exposure biomarker, and the value in additional research on these proteins under varying exposure scenarios, particularly environmentally realistic concentrations.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2020

Escherichia coli amino acid auxotrophic expression host strains for investigating protein structure–function relationships

Abstract A set of C43(DE3) and BL21(DE3) Escherichia coli host strains that are auxotrophic for various amino acids is briefly reviewed. These strains require the addition of a defined set of one or more amino acids in the growth medium, and have been specifically designed for overproduction of membrane or water-soluble proteins selectively labelled with stable isotopes, such as 2H, 13C and 15N. The strains described here are available for use and have been deposited into public strain banks. Although they cannot fully eliminate the possibility of isotope dilution and mixing, metabolic scrambling of the different amino acid types can be minimized through a careful consideration of the bacterial metabolic pathways. The use of a suitable auxotrophic expression host strain with an appropriately isotopically labelled growth medium ensures high levels of isotope labelling efficiency as well as selectivity for providing deeper insight into protein structure–function relationships.

Biochemistry & Molecular Biology↗
DOE OSTI2026

Multilayered regulation by RNA thermometers enables precise control of Cas9 expression in E. coli

Cas9-based genome editing technologies can rapidly generate mutations to probe a diverse array of mutant genotypes. However, aberrant Cas9 nuclease translation and activity can occur despite the use of inducible promoters to control expression, leading to extensive cell death. This background killing caused by promoter leakiness severely limits the application of Cas9 for generating mutant libraries because of the potential for population skew. We demonstrate the utility of temperature sensitive RNA elements as a layer of post-transcriptional regulation to reduce the impact of promoter leak. We observe significant temperature-dependent increases in cell survival when certain RNA thermometers (RNATs) are placed upstream of the cas9 coding sequence. We also show that the most highly repressing RNAT, hsp17rep, significantly reduces population skew with a library of characterized guide RNAs in Escherichia coli. This strategy should be applicable to all bacterial Cas9-based methods and technologies.

Kammerdiener, Elise K. [Oak Ridge National Laborat↗
DOE OSTI2020

A Group of O-Acetyltransferases Catalyze Xyloglucan Backbone Acetylation and Can Alter Xyloglucan Xylosylation Pattern and Plant Growth When Expressed in Arabidopsis

Abstract Xyloglucan is a major hemicellulose in plant cell walls and exists in two distinct types, XXXG and XXGG. While the XXXG-type xyloglucan from dicot species only contains O-acetyl groups on side-chain galactose (Gal) residues, the XXGG-type xyloglucan from Poaceae (grasses) and Solanaceae bears O-acetyl groups on backbone glucosyl (Glc) residues. Although O-acetyltransferases responsible for xyloglucan Gal acetylation have been characterized, the biochemical mechanism underlying xyloglucan backbone acetylation remains to be elucidated. In this study, we showed that recombinant proteins of a group of DUF231 members from rice and tomato were capable of transferring acetyl groups onto O-6 of Glc residues in cello-oligomer acceptors, indicating that they are xyloglucan backbone 6-O-acetyltransferases (XyBATs). We further demonstrated that XyBAT-acetylated cellohexaose oligomers could be readily xylosylated by AtXXT1 (Arabidopsis xyloglucan xylosyltransferase 1) to generate acetylated, xylosylated cello-oligomers, whereas AtXXT1-xylosylated cellohexaose oligomers were much less effectively acetylated by XyBATs. Heterologous expression of a rice XyBAT in Arabidopsis led to a severe reduction in cell expansion and plant growth and a drastic alteration in xyloglucan xylosylation pattern with the formation of acetylated XXGG-type units, including XGG, XGGG, XXGG, XXGG,XXGGG and XXGGG (G denotes acetylated Glc). In addition, recombinant proteins of two Arabidopsis XyBAT homologs also exhibited O-acetyltransferase activity toward cellohexaose, suggesting their possible role in mediating xyloglucan backbone acetylation in vivo. Our findings provide new insights into the biochemical mechanism underlying xyloglucan backbone acetylation and indicate the importance of maintaining the regular xyloglucan xylosylation pattern in cell wall function.

Cell Biology↗
DOE OSTI2021

Exogenous chalcone synthase expression in developing poplar xylem incorporates naringenin into lignins

Abstract Lignin, a polyphenolic polymer, is a major chemical constituent of the cell walls of terrestrial plants. The biosynthesis of lignin is a highly plastic process, as highlighted by an increasing number of noncanonical monomers that have been successfully identified in an array of plants. Here, we engineered hybrid poplar (Populus alba x grandidentata) to express chalcone synthase 3 (MdCHS3) derived from apple (Malus domestica) in lignifying xylem. Transgenic trees displayed an accumulation of the flavonoid naringenin in xylem methanolic extracts not inherently observed in wild-type trees. Nuclear magnetic resonance analysis revealed the presence of naringenin in the extract-free, cellulase-treated xylem lignin of MdCHS3-poplar, indicating the incorporation of this flavonoid-derived compound into poplar secondary cell wall lignins. The transgenic trees also displayed lower total cell wall lignin content and increased cell wall carbohydrate content and performed significantly better in limited saccharification assays than their wild-type counterparts.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

A mini-TGA protein modulates gene expression through heterogeneous association with transcription factors

Abstract TGA (TGACG-binding) transcription factors, which bind their target DNA through a conserved basic region leucine zipper (bZIP) domain, are vital regulators of gene expression in salicylic acid (SA)-mediated plant immunity. Here, we investigated the role of StTGA2.1, a potato (Solanum tuberosum) TGA lacking the full bZIP, which we named a mini-TGA. Such truncated proteins have been widely assigned as loss-of-function mutants. We, however, confirmed that StTGA2.1 overexpression compensates for SA-deficiency, indicating a distinct mechanism of action compared with model plant species. To understand the underlying mechanisms, we showed that StTGA2.1 can physically interact with StTGA2.2 and StTGA2.3, while its interaction with DNA was not detected. We investigated the changes in transcriptional regulation due to StTGA2.1 overexpression, identifying direct and indirect target genes. Using in planta transactivation assays, we confirmed that StTGA2.1 interacts with StTGA2.3 to activate StPRX07, a member of class III peroxidases (StPRX), which are known to play role in immune response. Finally, via structural modeling and molecular dynamics simulations, we hypothesized that the compact molecular architecture of StTGA2.1 distorts DNA conformation upon heterodimer binding to enable transcriptional activation. This study demonstrates how protein truncation can lead to distinct functions and that such events should be studied carefully in other protein families.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Gene Expression Thresholds Derived From Short-term Exposures Identify Rat Liver Tumorigens

Abstract Traditional methods for cancer risk assessment are resource-intensive, retrospective, and not feasible for the vast majority of environmental chemicals. In this study, we investigated whether quantitative genomic data from short-term studies may be used to set protective thresholds for potential tumorigenic effects. We hypothesized that gene expression biomarkers measuring activation of the key early events in established pathways for rodent liver cancer exhibit cross-chemical thresholds for tumorigenesis predictive for liver cancer risk. We defined biomarker thresholds for 6 major liver cancer pathways using training sets of chemicals with short-term genomic data (3–29 days of exposure) from the TG-GATES (n = 77 chemicals) and DrugMatrix (n = 86 chemicals) databases and then tested these thresholds within and between datasets. The 6 pathway biomarkers represented genotoxicity, cytotoxicity, and activation of xenobiotic, steroid, and lipid receptors (aryl hydrocarbon receptor, constitutive activated receptor, estrogen receptor, and peroxisome proliferator-activated receptor α). Thresholds were calculated as the maximum values derived from exposures without detectable liver tumor outcomes. We identified clear response values that were consistent across training and test sets. Thresholds derived from the TG-GATES training set were highly predictive (97%) in a test set of independent chemicals, whereas thresholds derived from the DrugMatrix study were 96%–97% predictive for the TG-GATES study. Threshold values derived from an abridged gene list (2/biomarker) also exhibited high predictive accuracy (91%–94%). These findings support the idea that early genomic changes can be used to establish threshold estimates or “molecular tipping points” that are predictive of later-life health outcomes.

Hill, III,, Thomas↗
DOE OSTI2025

The effects of expression of a hyperthermophilic endoglucanase and nutrient conditions on poplar growth and physiology

Abstract Efficient production and processing of poplar biomass feedstock requires costly pretreatments and enzyme additives. Transgenic alterations of poplar can reduce the need for these inputs by increasing biomass, improving lignocellulose quality and enhancing nutrient uptake. Previously, a transgenic line of poplar expressing a bacterial hyperthermophilic endoglucanase (TnCelB) in Populus alba × grandidentata (P39) was developed and characterized. This study reports the effects on the TnCelB transgenic poplar line under a reduced nutrient treatment. Overall, the nutrient treatment was the source of more observed significant differences than the genotype. Wild type and TnCelB poplar had similar responses in biomass allocation and net photosynthesis. TnCelB trees had a wrinkled leaf phenotype and relative to wild type, had reduced total biomass, reduced water-use efficiency, and a decreased proportion of cellulose to hemicellulose and lignin. In low nutrient conditions, TnCelB trees had increased structural carbohydrates with stable lignin values. The TnCelB line presents a viable option for poplar biomass feedstock, offering biomass comparable to wild type poplar and more efficient processing, with only mild negative phenotypes.

Natalie, Bethanie M. (ORCID:0009000843856585)↗
DOE OSTI2025

Analytical expression of a finite, long, conical canted-cosine-theta coil for particle collider interaction regions

Magnets in the accelerator interaction region (IR) present significant challenges because of high field requirements and limited available space. Conical-shaped magnets offer advantages in these environments by allowing closer placement to the interaction point while maintaining clearance from synchrotron radiation. Interestingly, numerical studies have shown that conical canted-cosine-theta (CCT) designs produce a constant field distribution along the axial direction in the IR quadrupoles for the Electron-Ion Collider (EIC) at Brookhaven National Laboratory. However, the field harmonics generated by conical CCT windings are not yet fully understood. This paper presents an analytical approach to describe the magnetic field produced by a conical surface current and proposes a method for designing conical CCT magnets for accelerator applications. First, we begin with a surface current sheet having a general cosine-theta distribution in spherical coordinates and solve the vector potential using the Green’s function. The magnetic fields generated by the conical current sheet are expressed using associated Legendre polynomials. These results are then related to circular field harmonics and integral field harmonics for designing a coil that produces a pure multipole field. Next, a single layer of the conical CCT winding path is produced based on the cosine-theta current distribution. Finally, the magnetic field quality of dipole and quadrupole conical CCT coils with multiple layers is verified using the Biot-Savart law.

Yang, Ye↗
DOE OSTI2025

Structural analysis of the NifL-NifA complex reveals the molecular basis of anti-activation of nitrogen fixation gene expression in Azotobacter vinelandii

Understanding the molecular basis of regulated nitrogen (N 2 ) fixation is essential for engineering N 2 -fixing bacteria that fulfill the demand of crop plants for fixed nitrogen, reducing our reliance on synthetic nitrogen fertilizers. In Azotobacter vinelandii and many other members of Proteobacteria, the two-component system comprising the anti-activator protein (NifL) and the Nif-specific transcriptional activator (NifA)controls the expression of nif genes, encoding the nitrogen fixation machinery. The NifL-NifA system evolved the ability to integrate several environmental cues, such as oxygen, nitrogen, and carbon availability. The nitrogen fixation machinery is thereby only activated under strictly favorable conditions, enabling diazotrophs to thrive in competitive environments. While genetic and biochemical studies have enlightened our understanding of how NifL represses NifA, the molecular basis of NifA sequestration by NifL depends on structural information on their interaction. Here, we present mechanistic insights into how nitrogen fixation is regulated by combining biochemical and genetic approaches with a low-resolution cryo-electron microscopy (cryo-EM) map of the oxidized NifL-NifA complex. Our findings define the interaction surface between NifL and NifA and reveal how this interaction can be manipulated to generate bacterial strains with increased nitrogen fixation rates able to secrete surplus nitrogen outside the cell, a crucial step in engineering improved nitrogen delivery to crop plants.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Simultaneous suppression of lignin, tricin and wall‐bound phenolic biosynthesis via the expression of monolignol 4‐ O ‐methyltransferases in rice

Summary Grass lignocelluloses feature complex compositions and structures. In addition to the presence of conventional lignin units from monolignols, acylated monolignols and flavonoid tricin also incorporate into lignin polymer; moreover, hydroxycinnamates, particularly ferulate, cross‐link arabinoxylan chains with each other and/or with lignin polymers. These structural complexities make grass lignocellulosics difficult to optimize for effective agro‐industrial applications. In the present study, we assess the applications of two engineered monolignol 4‐ O ‐methyltransferases (MOMTs) in modifying rice lignocellulosic properties. Two MOMTs confer regiospecific para ‐methylation of monolignols but with different catalytic preferences. The expression of MOMTs in rice resulted in differential but drastic suppression of lignin deposition, showing more than 50% decrease in guaiacyl lignin and up to an 90% reduction in syringyl lignin in transgenic lines. Moreover, the levels of arabinoxylan‐bound ferulate were reduced by up to 50%, and the levels of tricin in lignin fraction were also substantially reduced. Concomitantly, up to 11 μmol/g of the methanol‐extractable 4‐ O ‐methylated ferulic acid and 5–7 μmol/g 4‐ O ‐methylated sinapic acid were accumulated in MOMT transgenic lines. Both MOMTs in vitro displayed discernible substrate promiscuity towards a range of phenolics in addition to the dominant substrate monolignols, which partially explains their broad effects on grass phenolic biosynthesis. The cell wall structural and compositional changes resulted in up to 30% increase in saccharification yield of the de‐starched rice straw biomass after diluted acid‐pretreatment. These results demonstrate an effective strategy to tailor complex grass cell walls to generate improved cellulosic feedstocks for the fermentable sugar‐based production of biofuel and bio‐chemicals.

4-O-methylated↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗