Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “protoplast”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

35 records · Page 2
All sourcesNASA NTRSDOE OSTI
DOE OSTI2020

Knocking Out the Wall: Revised Protocols for Gene Targeting in Physcomitrella patens

The moss Physcomitrella patens has become established as a model for investigating plant gene function due to the feasibility of gene targeting. The chemical composition of the P. patens cell wall is similar to that of vascular plants and phylogenetic analyses of glycosyltransferase sequences from the P. patens genome have identified genes that putatively encode cell wall biosynthetic enzymes, providing a basis for investigating the evolution of cell wall polysaccharides and the enzymes that synthesize them. Here, the protocols described in this chapter provide methods for targeted gene knockout in P. patens, from constructing vectors and maintaining cultures to transforming protoplasts and analysing the genotypes and phenotypes of the resulting transformed lines.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Use of Fluorescent Protein Reporters for Assessing and Detecting Genome Editing Reagents and Transgene Expression in Plants

Fluorescent protein reporters have been widely used for monitoring the expression of target genes in various engineered organisms. Although a wide range of analytical approaches (e.g., genotyping PCR, digital PCR, DNA sequencing) have been utilized to detect and identify genome editing reagents and transgene expression in genetically modified plants, these methods are usually limited to use in the late stages of plant transformation and can only be used invasively. Here we describe GFP- and eYGFPuv-based strategies and methods for assessing and detecting genome editing reagents and transgene expression in plants, including protoplast transformation, leaf infiltration, and stable transformation. These methods and strategies enable easy, noninvasive screening of genome editing and transgenic events in plants.

Yuan, Guoliang↗
DOE OSTI2026

Genome shuffling enables quantitative trait locus mapping in Bacillus subtilis

Genetic mapping is a powerful tool for eukaryotic genetics that has only been applied to bacteria in limited circumstances. Quantitative trait locus (QTL) mapping generally relies on sexual recombination to break linkages between genes, yet bacteria rarely undergo sufficient homologous recombination to generate suitable mapping populations. In this work, we used iterative biparental genome shuffling by protoplast fusion in Bacillus subtilis to generate a population of bacteria with substantial random recombination throughout their genomes. Individual shuffled progeny were arrayed in well plates, resequenced, and characterized for a range of complex phenotypes including spore germination and swarming motility. Genetic mapping of the resulting phenotypes identified high-confidence QTLs of moderate size (~10 kb), and these associations were validated through targeted genetic swaps. This B. subtilis QTL population can easily be used to map additional phenotypes, and the general approach for QTL mapping is applicable in a wide range of bacteria.

Vasileva, Delyana [ORNL] (ORCID:0000000279197883)↗
DOE OSTI2023

CRISPR/Cas9-based gene activation and base editing in Populus

The genus Populus has long been used for environmental, agroforestry and industrial applications worldwide. Today Populus is also recognized as a desirable crop for biofuel production and a model tree for physiological and ecological research. As such, various modern biotechnologies, including CRISPR/Cas9-based techniques, have been actively applied to Populus for genetic and genomic improvements for traits such as increased growth rate and tailored lignin composition. However, CRISPR/Cas9 has been primarily used as the active Cas9 form to create knockouts in the hybrid poplar clone “717-1B4” (P. tremula x P. alba clone INRA 717-1B4). Alternative CRISPR/Cas9-based technologies, e.g. those involving modified Cas9 for gene activation and base editing, have not been evaluated in most Populus species for their efficacy. Here we employed a deactivated Cas9 (dCas9)-based CRISPR activation (CRISPRa) technique to fine-tune the expression of two target genes, TPX2 and LecRLK-G which play important roles in plant growth and defense response, in hybrid poplar clone “717-1B4” and poplar clone “WV94” (P. deltoides “WV94”), respectively. We observed that CRISPRa resulted in 1.2-fold to 7.0-fold increase in target gene expression through transient expression in protoplasts and Agrobacterium-mediated stable transformation, demonstrating the effectiveness of dCas9-based CRISPRa system in Populus. In addition, we applied Cas9 nickase (nCas9)-based cytosine base editor (CBE) to precisely introduce premature stop codons via C-to-T conversion, with an efficiency of 13%–14%, in the target gene PLATZ which encodes a transcription factor involved in plant fungal pathogen response in hybrid poplar clone “717-1B4”. Overall, we showcase the successful application of CRISPR/Cas-based technologies in gene expression regulation and precise gene engineering in two Populus species, facilitating the adoption of emerging genome editing tools in woody species.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

SPOTTED-LEAF7 targets the gene encoding β-galactosidase9, which functions in rice growth and stress responses

Abstract β-Galactosidases (Bgals) remove terminal β-D-galactosyl residues from the nonreducing ends of β-D-galactosidases and oligosaccharides. Bgals are present in bacteria, fungi, animals, and plants and have various functions. Despite the many studies on the evolution of BGALs in plants, their functions remain obscure. Here, we identified rice (Oryza sativa) β-galactosidase9 (OsBGAL9) as a direct target of the heat stress-induced transcription factor SPOTTED-LEAF7 (OsSPL7), as demonstrated by protoplast transactivation analysis and yeast 1-hybrid and electrophoretic mobility shift assays. Knockout plants for OsBGAL9 (Osbgal9) showed short stature and growth retardation. Histochemical β-glucuronidase (GUS) analysis of transgenic lines harboring an OsBGAL9pro:GUS reporter construct revealed that OsBGAL9 is mainly expressed in internodes at the mature stage. OsBGAL9 expression was barely detectable in seedlings under normal conditions but increased in response to biotic and abiotic stresses. Ectopic expression of OsBGAL9 enhanced resistance to the rice pathogens Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae, as well as tolerance to cold and heat stress, while Osbgal9 mutant plants showed the opposite phenotypes. OsBGAL9 localized to the cell wall, suggesting that OsBGAL9 and its plant putative orthologs likely evolved functions distinct from those of its closely related animal enzymes. Enzyme activity assays and analysis of the cell wall composition of OsBGAL9 overexpression and mutant plants indicated that OsBGAL9 has activity toward galactose residues of arabinogalactan proteins (AGPs). Our study clearly demonstrates a role for a member of the BGAL family in AGP processing during plant development and stress responses.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2020

Imaging of multiple fluorescent proteins in canopies enables synthetic biology in plants

Reverse genetics approaches have revolutionized plant biology and agriculture. Phenomics has the prospect of bridging plant phenotypes with genes, including transgenes, to transform agricultural fields. Genetically encoded fluorescent proteins (FPs) have revolutionized plant biology paradigms in gene expression, protein trafficking and plant physiology. While the first instance of plant canopy imaging of green fluorescent protein (GFP) was performed over 25 years ago, modern phenomics has largely ignored fluorescence as a transgene expression device despite the burgeoning FP colour palette available to plant biologists. Here, we show a new platform for stand-off imaging of plant canopies expressing a wide variety of FP genes. The platform-the fluorescence-inducing laser projector (FILP)-uses an ultra-low-noise camera to image a scene illuminated by compact diode lasers of various colours, coupled with emission filters to resolve individual FPs, to phenotype transgenic plants expressing FP genes. Each of the 20 FPs screened in plants were imaged at >3 m using FILP in a laboratory-based laser range. We also show that pairs of co-expressed fluorescence proteins can be imaged in canopies. The FILP system enabled a rapid synthetic promoter screen: starting from 2000 synthetic promoters transfected into protoplasts to FILP-imaged agroinfiltrated Nicotiana benthamiana plants in a matter of weeks, which was useful to characterize a water stress-inducible synthetic promoter. FILP canopy imaging was also accomplished for stably transformed GFP potato and in a split-GFP assay, which illustrates the flexibility of the instrument for analysing fluorescence signals in plant canopies.

abiotic stress↗
DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Optimization of multiplexed CRISPR/Cas9 system for highly efficient genome editing in Setaria viridis

Previously, Setaria viridis has been developed as a model plant to better understand the C4 photosynthetic pathway in major crops. With the increasing availability of genomic resources for S. viridis research, highly efficient genome editing technologies are needed to create genetic variation resources for functional genomics. In this paper, we developed a protoplast assay to rapidly optimize the multiplexed CRISPR/Cas9 system in S. viridis. Targeted mutagenesis efficiency was further improved by an average of 1.4-fold with the exonuclease, Trex2. Distinctive mutation profiles were found in the Cas9_Trex2 samples with 94% of deletions larger than 10bp, and less than 1% of mutations being insertions. Further analyses indicated that 52.2% of deletions induced by Cas9_Trex2, as opposed to 3.5% by Cas9 alone, were repaired through microhomology-mediated end joining (MMEJ) rather than the canonical NHEJ DNA repair pathway. Combined with the robust agrobacterium-mediated transformation method with more than 90% efficiency, the multiplex CRISPR/Cas9_Trex2 system was demonstrated to induce targeted mutations in two tightly linked genes, svDrm1a and svDrm1b, at the frequency ranging from 73% to 100% in T0 plants. These mutations were transmitted to at least 60% of the transgene-free T1 plants with 33% of them containing bi-allelic or homozygous mutations in both genes. This highly efficient multiplex CRISPR/Cas9_Trex2 system makes it possible to create a large mutant resource for S. viridis in a rapid and high throughput manner, and has the potential to be widely applicable in achieving more predictable MMEJ-mediated mutations in many plant species.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Combining genome-wide association studies and expression quantitative trait nucleotide mapping with molecular and genetic validations to identify transcriptional networks regulating drought tolerance in Populus

Objectives: (i). To deploy a large-scale experimental drought trial for up to 1000 unique genotypes of Populus equipping the sites with controlled irrigation and drought treatments that are fully automated and monitored. FULLY COMPLETED (ii) To test the hypothesis that a suite of traits identified for drought tolerance in P. nigra can be measured in drought and control treatments in the wide germplasm collection of P. trichocarpa. FULLY COMPLETED (iii) To use established and novel GWAS model approaches to identify gene loci linked to drought tolerance traits on interest in P. trichocarpa. FULLY COMPLETED (iv) To undertake comparative analysis of GWAS results for drought tolerance traits in P. nigra and P. trichocarpa. PARTIALLY COMPLETED – remains active (v) Using RNAseq in P. trichocarpa, in droughted and control treatments to identify cis- and trans-regulated eQTN. FULLY COMPLETED (vi) Validate up to 50 cis-QTNs, from network hubs using transient protoplast assays. FULLY COMPLETED (vii) To establish Agrobacterium-based gene editing protocols in Populus. FULLY COMPLETED (viii) To utilize early leads from previous research to investigate at least 6 candidate genes for drought tolerance in Populus. FULLY COMPLETED (ix) To validate up to 20 candidate genes for drought tolerance in P. trichocarpa refined from the long-list tested in the transient assays for cis-acting hub gene targets. PARTIALLY COMPLETED- remains active.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2026

Genome_shuffling_enables_quantitative_trait_locus_mapping_in_Bacillus_subtilis

Genetic mapping is a powerful tool for eukaryotic genetics that has only been applied to bacteria in limited circumstances. Quantitative trait locus (QTL) mapping generally relies on sexual recombination to break linkages between genes, yet bacteria rarely undergo sufficient homologous recombination to generate suitable mapping populations. In this work, we used iterative biparental genome shuffling by protoplast fusion inBacillus subtilisto generate a population of bacteria with substantial random recombination throughout their genomes. Individual shuffled progeny were arrayed in well plates, resequenced, and characterized for a range of complex phenotypes including spore germination and swarming motility. Genetic mapping of the resulting phenotypes identified high-confidence QTLs of moderate size (∼10 kb), and these associations were validated through targeted genetic swaps. ThisB. subtilisQTL population can easily be used to map additional phenotypes, and the general approach for QTL mapping is applicable in a wide range of bacteria.

Bacillus subtilis↗
DOE OSTI2023

Establishment of a genome editing tool using CRISPR-Cas9 ribonucleoprotein complexes in the non-model plant pathogen Sphaerulina musiva

CRISPR-Cas9 is a versatile genome editing system widely used since 2013 to introduce site-specific modifications into the genomes of model and non-model species. This technology is used in various applications, from gene knock-outs, knock-ins, and over-expressions to more precise changes, such as the introduction of nucleotides at a targeted locus. CRISPR-Cas9 has been demonstrated to be easy to establish in new species and highly efficient and specific compared to previous gene editing strategies such as Zinc finger nucleases and transcription activator-like effector nucleases. Grand challenges for emerging CRISPR-Cas9 tools in filamentous fungi are developing efficient transformation methods for non-model organisms. In this paper, we have leveraged the establishment of CRISPR-Cas9 genome editing tool that relies on Cas9/sgRNA ribonucleoprotein complexes (RNPs) in the model species Trichoderma reesei and developed the first protocol to efficiently transform the non-model species, Sphaerulina musiva. This fungal pathogen constitutes a real threat to the genus Populus, a foundational bioenergy crop used for biofuel production. Herein, we highlight the general considerations to design sgRNAs and their computational validation. We also describe the use of isolated protoplasts to deliver the CRISPR-Cas9 RNP components in both species and the screening for targeted genome editing events. The development of engineering tools in S. musiva can be used for studying genes involved in diverse processes such as secondary metabolism, establishment, and pathogenicity, among many others, but also for developing genetic mitigation approaches. The approach described here provides guidance for potential development of transformation systems in other non-model spore-bearing ascomycetes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Comparative feedstock analysis in Setaria viridis L. as a model for C 4 bioenergy grasses and panicoid crop species

Second generation feedstocks for bioethanol will likely include a sizable proportion of perennial C4 grasses, principally in the Panicoideae clade. The Panicoideae contain agronomically important annual grasses including Zea mays L. (maize), Sorghum bicolor (L.) Moench (sorghum), and Saccharum officinarum L. (sugar cane) as well as promising second generation perennial feedstocks including Miscanthus × giganteus and Panicum virgatum L. (switchgrass). The underlying complexity of these polyploid grass genomes is a major limitation for their direct manipulation and thus driving a need for rapidly cycling comparative model. Setaria viridis (green millet) is a rapid cycling C4 panicoid grass with a relatively small and sequenced diploid genome and abundant seed production. Stable, transient, and protoplast transformation technologies have also been developed for Setaria viridis making it a potentially excellent model for other C4 bioenergy grasses. Here, the lignocellulosic feedstock composition, cellulose biosynthesis inhibitor response and saccharification dynamics of Setaria viridis are compared with the annual sorghum and maize and the perennial switchgrass bioenergy crops as a baseline study into the applicability for translational research. A genome-wide systematic investigation of the cellulose synthase-A genes was performed identifying eight candidate sequences. Two developmental stages; (a) metabolically active young tissue and (b) metabolically plateaued (mature) material are examined to compare biomass performance metrics.

09 BIOMASS FUELS↗
DOE OSTI2022

Functional analysis of Pogostemon cablin farnesyl pyrophosphate synthase gene and its binding transcription factor PcWRKY44 in regulating biosynthesis of patchouli alcohol

Farnesyl pyrophosphate synthase (FPPS) plays an important role in the synthesis of plant secondary metabolites, but its function and molecular regulation mechanism remain unclear in Pogostemon cablin . In this study, the full-length cDNA of the FPP synthase gene from P. cablin ( PcFPPS ) was cloned and characterized. The expressions of PcFPPS are different among different tissues (highly in P. cablin flowers). Subcellular localization analysis in protoplasts indicated that PcFPPS was located in the cytoplasm. PcFPPS functionally complemented the lethal FPPS deletion mutation in yeast CC25. Transient overexpression of PcFPPS in P. cablin leaves accelerated terpene biosynthesis, with an ~47% increase in patchouli alcohol. Heterologous overexpression of PcFPPS in tobacco plants was achieved, and it was found that the FPP enzyme activity was significantly up-regulated in transgenic tobacco by ELISA analysis. In addition, more terpenoid metabolites, including stigmasterol, phytol, and neophytadiene were detected compared with control by GC-MS analysis. Furthermore, with dual-LUC assay and yeast one-hybrid screening, we found 220 bp promoter of PcFPPS can be bound by the nuclear-localized transcription factor PcWRKY44. Overexpression of PcWRKY44 in P. cablin upregulated the expression levels of PcFPPS and patchoulol synthase gene ( PcPTS ), and then promote the biosynthesis of patchouli alcohol. Taken together, these results strongly suggest the PcFPPS and its binding transcription factor PcWRKY44 play an essential role in regulating the biosynthesis of patchouli alcohol.

Wang, Xiaobing↗
DOE OSTI2023

GmMPK6 Positively Regulates Salt Tolerance through Induction of GmRbohI1 in Soybean

Salt stress is a critical environmental stress that impairs plant growth and development, especially in crop productivity; therefore, understanding the salt response in plants is the basis for their development of salt tolerance. Under salinity, soybean mitogen-activated protein kinase 6 (GmMPK6) is activated and positively regulates reactive oxygen species (ROS) generation. However, it is not yet elucidated how GmMPK6 regulates ROS generation and its role in salt tolerance. Here, we show that GmMPK6, solely activated in NaCl treatment, and gene expression of GmRbohI1 was not only reduced by MPK inhibitor SB202190 in NaCl treatment, but also increased in a GMKK1-expressing protoplast. Furthermore, SB202190 and the NADPH-oxidase inhibitor, diphenyleneiodonium chloride, increased susceptibility to salt stress. The expression of GmRD19A was induced by NaCl treatment, but this expression was compromised by SB202190. Consequently, we revealed that GmMPK6 induces ROS generation through the transcriptional regulation of GmRbohI1 and increases salt tolerance in soybean.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Two Alternative Splicing Variants of AtERF73/HRE1, HRE1α and HRE1β, Have Differential Transactivation Activities in Arabidopsis

AtERF73/HRE1 is an AP2/ERF transcription factor in Arabidopsis and has two distinct alternative splicing variants, HRE1α and HRE1β. In this study, we examined the differences between the molecular functions of HRE1α and HRE1β. We found that HRE1α and HRE1β are both involved in hypoxia response and root development and have transactivation activity. Two conserved motifs in the C-terminal region of HRE1α and HRE1β, EELL and LWSY-like, contributed to their transactivation activity, specifically the four E residues in the EELL motif and the MGLWS amino acid sequence at the end of the LWSY-like motif. The N-terminal region of HRE1β also showed transactivation activity, mediated by the VDDG motif, whereas that of HRE1α did not. The transactivation activity of HRE1β was stronger than that of HRE1α in Arabidopsis protoplasts. Both transcription factors transactivated downstream genes via the GCC box. RNA-sequencing analysis further supported that both HRE1α and HRE1β might regulate gene expression associated with the hypoxia stress response, although they may transactivate different subsets of genes in downstream pathways. Our results, together with previous studies, suggested that HRE1α and HRE1β differentially transactivate downstream genes in hypoxia response and root development in Arabidopsis.

36 MATERIALS SCIENCE↗
DOE OSTI2023

Elucidating Mechanisms of Rust Pathogenesis for Engineering Resistance in Poplar

The overall objective of this research was to elucidate the molecular basis for the virulence of Melampsora larici-populina towards Populus spp. in order to address the formidable challenge of engineering durable resistance in poplar against leaf rust. Our original research plan was built on the technically innovative approach of using dual host systems and known host defense proteins and pathogen avirulent effectors along with genome-wide approaches to identify key pathogenesis effectors of Melampsora larici-populina that target poplar defense and nutrient acquisition. Our efforts focused on developing high-throughput experimental approaches and systems to enable us to address our overarching hypothesis that rust effectors with homology to other fungal effectors will either bypass the poplar immune system and/or suppress effector-triggered immunity through conserved mechanisms, and that an analysis of these interaction networks would provide for new approaches to develop rust-resistant poplar. Three main objectives were originally proposed: (1) mine key rust effectors that suppress host immunity; (2) elucidate interaction networks in poplar targeted by key rust effectors; (3) generate transgenic poplar resources for identification of genes involved in pathogen infection or host defense triggered by rust. Generally, we worked towards all three objectives by developing and applying complementary molecular, genomic, biochemical and plant transformation approaches.

54 ENVIRONMENTAL SCIENCES↗