Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “SPECIFICATIONS”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2
All sourcesNASA NTRSDOE OSTI
DOE OSTI2023

Specificity in plant-mycorrhizal fungal relationships: prevalence, parameterization, and prospects

Species interactions exhibit varying degrees of specialization, ranging from generalist to specialist interactions. For many interactions (e.g., plant-microbiome) we lack standardized metrics of specialization, hindering our ability to apply comparative frameworks of specificity across niche axes and organismal groups. Here, we discuss the concept of plant host specificity of arbuscular mycorrhizal (AM) fungi and ectomycorrhizal (EM) fungi, including the predominant theories for their interactions: Passenger, Driver, and Habitat Hypotheses. We focus on five major areas of interest in advancing the field of plant-mycorrhizal fungal host specificity: phylogenetic specificity, host physiology specificity, functional specificity, habitat specificity, and mycorrhizal fungal-mediated plant rarity. Considering the need to elucidate foundational concepts of specificity in this globally important symbiosis, we propose standardized metrics and comparative studies to enhance our understanding. We also emphasize the importance of analyzing global mycorrhizal data holistically to draw meaningful conclusions and suggest a shift toward single-species analyses to unravel the complexities underlying these associations.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Vaccination with mycobacterial lipid loaded nanoparticle leads to lipid antigen persistence and memory differentiation of antigen-specific T cells

Mycobacterium tuberculosis (Mtb) infection elicits both protein and lipid antigen-specific T cell responses. However, the incorporation of lipid antigens into subunit vaccine strategies and formulations has been underexplored, and the characteristics of vaccine-induced Mtb lipid-specific memory T cells have remained elusive. Mycolic acid (MA), a major lipid component of the Mtb cell wall, is presented by human CD1b molecules to unconventional T cell subsets. These MA-specific CD1b-restricted T cells have been detected in the blood and disease sites of Mtb-infected individuals, suggesting that MA is a promising lipid antigen for incorporation into multicomponent subunit vaccines. In this study, we utilized the enhanced stability of bicontinuous nanospheres (BCN) to efficiently encapsulate MA for in vivo delivery to MA-specific T cells, both alone and in combination with an immunodominant Mtb protein antigen (Ag85B). Pulmonary administration of MA-loaded BCN (MA-BCN) elicited MA-specific T cell responses in humanized CD1 transgenic mice. Simultaneous delivery of MA and Ag85B within BCN activated both MA- and Ag85B-specific T cells. Notably, pulmonary vaccination with MA-Ag85B-BCN resulted in the persistence of MA, but not Ag85B, within alveolar macrophages in the lung. Vaccination of MA-BCN through intravenous or subcutaneous route, or with attenuated Mtb likewise reproduced MA persistence. Moreover, MA-specific T cells in MA-BCN-vaccinated mice differentiated into a T follicular helper-like phenotype. Overall, the BCN platform allows for the dual encapsulation and in vivo activation of lipid and protein antigen-specific T cells and leads to persistent lipid depots that could offer long-lasting immune responses.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Is the exquisite specificity of lymphocytes generated by thymic selection or due to evolution?

We have previously argued that the antigen receptors of T and B lymphocytes evolved to be sufficiently specific to avoid massive deletion of clonotypes by negative selection. Their optimal ‘specificity’ level, i.e., probability of binding any particular epitope, was shown to be inversely related to the number of self-antigens that the cells have to be tolerant to. Experiments have demonstrated that T lymphocytes also become more specific during negative selection in the thymus, because cells expressing the most crossreactive receptors have the highest likelihood of binding a self-antigen, and hence to be tolerized (i.e., deleted, anergized, or diverted into a regulatory T cell phenotype). Thus, there are two —not mutually exclusive— explanations for the exquisite specificity of T cells, one involving evolution and the other thymic selection. To better understand the impact of both, we extend a previously developed mathematical model by allowing for T cells with very different binding probabilities in the pre-selection repertoire. We confirm that negative selection tends to tolerize the most crossreactive clonotypes. As a result, the average level of specificity in the functional post-selection repertoire depends on the number of self-antigens, even if there is no evolutionary optimization of binding probabilities. However, the evolutionary optimal range of binding probabilities in the pre-selection repertoire also depends on the number of self-antigens. Species with more self antigens need more specific pre-selection repertoires to avoid excessive loss of T cells during thymic selection, and hence mount protective immune responses. We conclude that both evolution and negative selection are responsible for the high level of specificity of lymphocytes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Position-specific carbon isotope analysis of serine by gas chromatography/Orbitrap mass spectrometry, and an application to plant metabolism

Position-specific 13 C/ 12 C ratios within amino acids remain largely unexplored in environmental samples due to methodological limitations. We hypothesized that natural-abundance isotope patterns in serine may serve as a proxy for plant metabolic fluxes including photorespiration. Here we describe an Orbitrap method optimized for the position-specific carbon isotope analysis of serine to test our hypothesis and discuss the generalizability of this method to other amino acids. Position-specific carbon isotope ratios of serine were measured using a Thermo Scientific™ Q Exactive™ GC Orbitrap™. Amino acids were hydrolyzed from Arabidopsis biomass, purified from potential matrix interferences, and derivatized alongside standards. Derivatized serine (N,O-bis(trifluoroacetyl)methyl ester) was isolated using gas chromatography, trapped in a reservoir, and purged into the electron ionization source over tens of minutes, producing fragment ions containing different combinations of atoms from the serine-derivative molecule. The 13 C/ 12 C ratios of fragments with monoisotopic masses of 110.0217, 138.0166, and 165.0037 Da were monitored in the mass analyzer and used to calculate position-specific δ 13 C values relative to a working standard. This methodology constrains position-specific δ 13 C values for nanomole amounts of serine isolated from chemically complex mixtures. The δ 13 C values of fragment ions of serine were characterized with ≤1‰ precisions, leading to propagated standard errors of 0.7–5‰ for each carbon position. Position-specific δ 13 C values differed by up to ca 28 ± 5‰ between serine molecules hydrolyzed from plants grown under contrasting pCO 2 , selected to promote different fluxes through photosynthesis and photorespiration. The method was validated using pure serine standards characterized offline. Here this study presents the first Orbitrap-based measurements of natural-abundance, position-specific carbon isotope variation in an amino acid isolated from a biological matrix. We present a method for the precise characterization of isotope ratios in serine and propose applications probing metabolism in plants. We discuss the potential for extending these approaches to other amino acids, paving the way for novel applications.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Identification of candidate host-specificity genes in Exserohilum turcicum using comparative genomics and transcriptomics

Abstract Exserohilum turcicum causes northern corn leaf blight and sorghum leaf blight. While the same species cause disease in both crops, the strains are host-specific. Here, we report the sequence and de novo annotated assemblies of one sorghum- and one maize-specific E. turcicum strain. The strains were sequenced using the PacBio Sequel II system. The total genome length for both assemblies was between 44 and 45 Mb with N50 of ∼2.5 Mb. Ninety-eight percent of the Benchmarking Universal Single-Copy Orthologs (BUSCO) for both assemblies had complete status. The estimated number of genes was 11,762 and 12,029 in the sorghum- and maize-specific isolates, respectively. Funannotate, EffectorP, SignalP, and transcriptome data were used to create functional annotation of each genome. The whole-genome comparison identified ten large-scale inversions and three translocations between the maize- and sorghum-specific strains, along with homologous genes and gene duplications. RNA was sequenced from the maize- and sorghum-specific isolate 10 days post-inoculation in maize and sorghum and from axenic cultures. Gene expression data from planta and axenic growth experiments were compared for each strain. Candidate host-specificity genes were identified by combining results from whole-genome comparison, synteny analysis, gene annotations, and transcriptome data. Overall, this study identified several candidate host-specificity genes that provide insights into E. turcicum interaction with its hosts.

Krone, Mara J. (ORCID:0000000159006624)↗
DOE OSTI2025

Decoding substrate specificity determining factors in glycosyltransferase-B enzymes – insights from machine learning models

Substrate specificity is an essential characteristic of any enzyme's function and an understanding of the factors that determine this specificity is crucial for enzyme engineering. Unlike the structure of an enzyme which is directly impacted by its sequence, substrate specificity as an enzyme attribute involves a rather indirect relationship with sequence as it also depends on structural aspects that dictate substrate accessibility and active site dynamics. In this study, we explore the performance of classifier-based machine learning models trained on curated sequence and structural data for a class of glycosyltransferases (GTs), namely GT-Bs, to understand their substrate specificity determining factors. GTs enable the transfer of sugar moieties to other biomolecules such as oligosaccharides or proteins and are found in all kingdoms of life. In plants, GTs participate in the biosynthesis of plant cell wall biopolymers (e.g.: hemicelluloses and pectins) and are an integral part of the enzymatic machinery that enables the storage of carbon and energy as plant biomass. To elucidate the substrate specificity of uncharacterized GT-Bs, we constructed multi-label machine learning models (Support Vector Classifier, K-Nearest Neighbors, Gaussian Naïve-Bayes, Random Forest) that incorporate both sequence and structural features. These models achieve good predictive accuracies on test datasets. However, despite our use of structural information, we highlight that there is further scope for improvement in training these models to draw interpretable relationships between sequence, structure and substrate specificity determining motifs in GT-Bs.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2024

Plant-specific microbial diversity facilitates functional redundancy at the soil-root interface

Abstract Aims Plant-specific microbial diversity reflecting host-microbe coevolution was frequently shown at the structural level but less on the functional scale. We studied the microbiome of three compartments at the soil root interface (root endosphere, rhizosphere, bulk soil) of medicinal plants cultivated under organic management in Egypt. The study aimed to examine the impact of the rhizosphere on microbial community composition and diversity in desert agricultural soil, as well as to identify specific functions associated with the rhizosphere. Methods The microbiome community structure, diversity, and microbial functioning were evaluated through the utilization of 16S rRNA gene amplicon and shotgun metagenome sequencing. Results We found the typical rhizosphere effect and plant-species-specific enrichment of bacterial diversity. The annual plants Calendula officinalis and Matricaria chamomilla ( Asteraceae ) were more similar than the perennial Solanum distichum ( Solanaceae ). Altogether, plant species explained 50.5% of the variation in bacterial community structures in the rhizosphere. Our results indicate a stronger effect of the plant species in terms of modulating bacterial community structures in the rhizosphere than in root endosphere samples. The plant-driven rhizosphere effect could be linked to redundant plant beneficial functions in the microbiome, while enrichment of specific genes related to amino acid ion transport and metabolism, carbohydrate transport and metabolism, defense mechanisms, and secondary metabolites biosynthesis were more specific. Conclusions The study explores the microbiome continuum at the soil-root interface of medicinal plant species, revealing significant bacterial community structure shifts and plant specificity. The study provides insights into the essential microbiome components contributing to rhizosphere functionality.

Wicaksono, Wisnu Adi (ORCID:0000000215561981)↗
DOE OSTI2023

Quantifying metal-binding specificity of Cc NikZ-II from Clostridium carboxidivorans in the presence of competing metal ions

Many proteins bind transition metal ions as cofactors to carry out their biological functions. Despite binding affinities for divalent transition metal ions being predominantly dictated by the Irving-Williams series for wild-type proteins, in vivo metal ion binding specificity is ensured by intracellular mechanisms that regulate free metal ion concentrations. However, a growing area of biotechnology research considers the use of metal-binding proteins in vitro to purify specific metal ions from wastewater, where specificity is dictated by the protein's metal binding affinities. A goal of metalloprotein engineering is to modulate these affinities to improve a protein's specificity towards a particular metal; however, the quantitative relationship between the affinities and the equilibrium metal-bound protein fractions depends on the underlying binding mechanisms. Here we demonstrate a high-throughput intrinsic tryptophan fluorescence quenching method to validate binding models in multi-metal solutions for CcNikZ-II, a nickel-binding protein from Clostridium carboxidivorans. Using our validated models, we quantify the relationship between binding affinity and specificity in different classes of metal-binding models for CcNikZ-II. In conclusion, we further illustrate the potential relevance of data-informed models to predicting engineering targets for improved specificity.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Modifying Specific Ion Effects: Studies of Monovalent Ion Interactions with Amines

Specific ion effects in the interactions of monovalent anions with amine groups-one of the hydrophilic moieties found in proteins-were investigated using octadecylamine monolayers floating at air–aqueous solution interfaces. Here, we find that at solution pH 5.7, larger monovalent anions induce a nonzero pressure starting at higher areas/molecules, i.e., a wider “liquid expanded” region in the monolayer isotherms. Using X-ray fluorescence at near total reflection (XFNTR), an element- and surface-specific technique, ion adsorption to the amines at pH 5.7 is confirmed to be ion-specific and to follow the conventional Hofmeister series. However, at pH 4, this ion specificity is no longer observed. We propose that at the higher pH, the amine headgroups are only partially protonated, and large polarizable ions such as iodine are better able to boost amine protonation. At the lower pH, on the other hand, the monolayer is fully protonated, and electrostatic interactions dominate over ion specificity. These results demonstrate that ion specificity can be modified by changing the experimental conditions.

36 MATERIALS SCIENCE↗
DOE OSTI2023

A spatio-temporally constrained gene regulatory network directed by PBX1/2 acquires limb patterning specificity via HAND2

A lingering question in developmental biology has centered on how transcription factors with widespread distribution in vertebrate embryos can perform tissue-specific functions. Here, using the murine hindlimb as a model, we investigate the elusive mechanisms whereby PBX TALE homeoproteins, viewed primarily as HOX cofactors, attain context-specific developmental roles despite ubiquitous presence in the embryo. We first demonstrate that mesenchymal-specific loss of PBX1/2 or the transcriptional regulator HAND2 generates similar limb phenotypes. By combining tissue-specific and temporally controlled mutagenesis with multi-omics approaches, we reconstruct a gene regulatory network (GRN) at organismal-level resolution that is collaboratively directed by PBX1/2 and HAND2 interactions in subsets of posterior hindlimb mesenchymal cells. Genome-wide profiling of PBX1 binding across multiple embryonic tissues further reveals that HAND2 interacts with subsets of PBX-bound regions to regulate limb-specific GRNs. Our research elucidates fundamental principles by which promiscuous transcription factors cooperate with cofactors that display domain-restricted localization to instruct tissue-specific developmental programs.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Predicting oncology drug-induced cardiotoxicity with donor-specific iPSC-CMs—a proof-of-concept study with doxorubicin

Abstract Many oncology drugs have been found to induce cardiotoxicity in a subset of patients, which significantly limits their clinical use and impedes the benefit of lifesaving anticancer treatments. Human induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) carry donor-specific genetic information and have been proposed for exploring the interindividual difference in oncology drug-induced cardiotoxicity. Herein, we evaluated the inter- and intraindividual variability of iPSC-CM-related assays and presented a proof of concept to prospectively predict doxorubicin (DOX)-induced cardiotoxicity (DIC) using donor-specific iPSC-CMs. Our findings demonstrated that donor-specific iPSC-CMs exhibited greater line-to-line variability than the intraindividual variability in impedance cytotoxicity and transcriptome assays. The variable and dose-dependent cytotoxic responses of iPSC-CMs resembled those observed in clinical practice and largely replicated the reported mechanisms. By categorizing iPSC-CMs into resistant and sensitive cell lines based on their time- and concentration-related phenotypic responses to DOX, we found that the sensitivity of donor-specific iPSC-CMs to DOX may predict in vivo DIC risk. Furthermore, we identified a differentially expressed gene, DND microRNA-mediated repression inhibitor 1 (DND1), between the DOX-resistant and DOX-sensitive iPSC-CMs. Our results support the utilization of donor-specific iPSC-CMs in assessing interindividual differences in DIC. Further studies will encompass a large panel of donor-specific iPSC-CMs to identify potential novel molecular and genetic biomarkers for predicting DOX and other oncology drug-induced cardiotoxicity.

Toxicology↗
DOE OSTI2022

To image, or not to image: class-specific diffractive cameras with all-optical erasure of undesired objects

Abstract Privacy protection is a growing concern in the digital era, with machine vision techniques widely used throughout public and private settings. Existing methods address this growing problem by, e.g., encrypting camera images or obscuring/blurring the imaged information through digital algorithms. Here, we demonstrate a camera design that performs class-specific imaging of target objects with instantaneous all-optical erasure of other classes of objects. This diffractive camera consists of transmissive surfaces structured using deep learning to perform selective imaging of target classes of objects positioned at its input field-of-view. After their fabrication, the thin diffractive layers collectively perform optical mode filtering to accurately form images of the objects that belong to a target data class or group of classes, while instantaneously erasing objects of the other data classes at the output field-of-view. Using the same framework, we also demonstrate the design of class-specific permutation and class-specific linear transformation cameras, where the objects of a target data class are pixel-wise permuted or linearly transformed following an arbitrarily selected transformation matrix for all-optical class-specific encryption, while the other classes of objects are irreversibly erased from the output image. The success of class-specific diffractive cameras was experimentally demonstrated using terahertz (THz) waves and 3D-printed diffractive layers that selectively imaged only one class of the MNIST handwritten digit dataset, all-optically erasing the other handwritten digits. This diffractive camera design can be scaled to different parts of the electromagnetic spectrum, including, e.g., the visible and infrared wavelengths, to provide transformative opportunities for privacy-preserving digital cameras and task-specific data-efficient imaging.

47 OTHER INSTRUMENTATION↗
DOE OSTI2025

Calcium is associated with specific soil organic carbon decomposition products at Blodgett Forest Research Center, Georgetown, California as analysed with scanning transmission X-ray microscopy carbon near-edge X-ray absorption fine structure spectroscopy

This data is from the paper calcium is associated with specific soil organic carbon decomposition products, published in SOIL. DOI: https://doi.org/10.5194/soil-11-381-2025, 2025.This file contains CSVs with spectral data and bulk soil data and there is no specific program required to open this data. The data includes Scanning transmission X-ray microscopy carbon near-edge X-ray absorption fine structure spectroscopy. data from the measurement of samples from the Whole-soil Warming project, run by the Belowground Biogeochemistry team at Blodgett Forest Research Center, Georgetown, California run by the University of California, Berkeley. It also includes bulk soil chemical properties. The University of California's Blodgett Forest Research Station (Forest) is situated in the Sierra Nevada foothills (1370 m a.s.l.) near Georgetown, California. The samples were collected from here: 38.912013, -120.661469, https://maps.app.goo.gl/291bCJ1zVqUhgktz6. The Forest soils were characterised as Alfisols, which are equivalent to Dystric Cambisols (IUSS Working Group WRB, 2015), and formed in granitic parent materials, in a temperate climate, under thinned, mixed-coniferous forest (Fig. S3; Gaudinski et al., 2009). With these analyses we aimed to answer the question, is calcium associated with a specific type of organic matter enriched in aromatic and phenolic carbon at the microscale in samples from Blodgett Forest Research Center? and how does this specific type of carbon respond to experiments targetted at removing and adding calcium to the soils, specifically cation exchange and incubation after calcium addition? Abstract from the paper can be found below: Calcium (Ca) may contribute to the preservation of soil organic carbon (SOC) in more ecosystems than previously thought. Here we provide evidence that Ca is co-located with SOC compounds that are enriched in aromatic and phenolic groups, across different acidic soil-types and locations with different ecosystem properties, differing in terms of climate, parent material, soil type, and vegetation. In turn, this co-localised fraction of Ca-SOC is removed through cation-exchange, and the association is then only re-established during decomposition in the presence of Ca (Ca addition incubation). Thus, highlighting a causative link between decomposition and the co-location of Ca with a characteristic fraction of SOC. Decomposition increases the relative proportion of negatively charged functional groups, which can increase the propensity for the association between SOC and Ca, and in turn, this association inhibits dissolved organic carbon export or further decomposition. We propose that this mechanism could be driven by Ca hotspots on the microscale shifting local decomposition processes and thereby explaining the colocation of Ca with SOC of a specific composition across different acidic soil environments. Incorporating this biogeochemical process into Earth System Models could improve our understanding, predictions, and management of carbon dynamics in soils, and account for their response to Ca-rich amendments.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2023

3D Printed eutectic aluminum alloy has facility for site-specific properties

Additive manufacturing (AM) has the ability to print structures with site-specific properties. Existing AM approaches for site-specific properties are, however, based on complex processing-microstructure relationships in conventional alloys that were not designed for this purpose. Here, in this work, we report a straightforward approach for achieving site-specific properties that takes advantage of eutectic solidification characteristics. We demonstrate that the yield strength of a eutectic Al-Cu-Ce-Zr alloy can be tuned by varying the laser scan speed in concert with hatch spacing in laser powder bed fusion AM. A faster speed increases solidification rate resulting in finer eutectic spacing and higher strength. The hatch spacing is reduced at faster speeds to ensure overlap between melt pools which become smaller with increasing scan speed. The yield strength and its anisotropy relative to build direction are further tunable with a heat treatment. The scan speed-eutectic spacing-strength relationship is successfully applied to print a complex pattern of site-specific hardness in the alloy. The generalized principle of using AM for a eutectic alloy to create site-specific properties and anisotropy in properties is demonstrated.

36 MATERIALS SCIENCE↗
DOE OSTI2026

Novel Cell-Type-Specific Drought-Responsive Proteins in Root Tips of Field-Grown Perennial Switchgrass

The root-tip region of plants, including the root cap, forms the most basal terminal of the root and exhibits a high degree of cellular complexity in terms of morphology, cytological function, and interaction with environmental cues in the soil. Cells in this region follow a developmental trajectory, transitioning from stem cells to meristematic cells, and ultimately to fully differentiated cell types. However, our understanding of root-tip cell-type specific proteomic responses to abiotic stresses, such as drought, particularly under field conditions, remains limited. This study aimed to identify spatially resolved, cell type-specific proteomes in switchgrass (Panicum virgatum) root tips under drought stress. Root tips were collected from seven-year-old, field-grown switchgrass ‘Alamo’ plants excavated under both well-watered and long-term drought conditions. Cell type-specific proteins were identified using laser capture microdissection (LCM) coupled with nanoPOTS (Nanodroplet Processing in One Pot for Trace Samples) and nano-LC-MS proteomics analysis. Five distinct cell types were targeted: (1) cells in the quiescent center and stem cell niche (QuC), (2) protodermal epidermal cells (PEC) in the meristematic zone, (3) epidermal cells in the transition and elongation zones above the root cap (Epi), (4) peripheral root cap cells (PRC), forming 2–3 layers below the PEC and 1–2 layers above the root border cells, and (5) columella root cap cells (Col) comprising of the columella initials and a single underlying layer of cells undergoing active growth. Principal component analysis (PCA) revealed clear separation among the five targeted cell types, confirming distinct proteomic profiles. Proteins predominantly enriched in each cell type were linked to distinct cellular functions, with QuC cells showing involvement in chromosomal behavior, DNA replication, and mitosis—key processes for stem cell niche regulation. Drought stress resulted in alterations of proteostasis, as evidenced by significant decreases in ribosomal proteins and increases in protein synthesis inhibitors. Moreover, drought stress induced unique cell-type–specific proteins involved in phytohormone biosynthesis and signaling pathways, including auxin, cytokinin, and jasmonic acid. In particular, QuC cells were more highly enriched in proteins associated with DNA repair and mitotic processes. Metabolic pathways related to amino acids, carbohydrates, and lipids were differentially affected in a cell-type–dependent manner, whereas general stress-responsive proteins exhibited consistent changes across all five cell types. Overall, this study provides unique spatially resolved, cell-type-specific proteomic profiles in root tips, representing a significant advancement in our understanding of the cellular mechanisms underlying plant responses to drought stress in natural field conditions.

perennial grass↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Design Basis Document / Owner’s Technical Specification for Nitrate Salt Systems in CSP Projects (Final Technical Report)

The number of commercial coal, gas, and nuclear projects built over the past 100 years number in the thousands. As such, there is a large database, available to a wide range of commercial engineering contractors, on proven designs. In essence, unsuccessful designs have, through generations of iterations, been identified and then deleted from further consideration. In contrast, the number of commercial parabolic trough projects using nitrate salt for the thermal storage media is perhaps 60. Further, the number of commercial central receiver projects using nitrate salt as the working fluid is on the order of 20, including estimates for China. Given the relative immaturity of salt technology, and commercial pressures to successfully bid new solar projects into a mature electricity market, solar projects often promise more than has been delivered. The Design Basis Document / Owner’s Technical Specification is a first step in the iteration process. The report describes the successful features of commercial projects, outlines a range equipment and system failures in projects that didn’t operate as intended, and provides a draft set of design changes intended to correct the known problems. The product of the study is 3 volumes of technical material; one volume is on parabolic trough technologies; a second is on central receiver technologies, and the third is on potential design changes to parabolic trough and central receiver projects. The 3 volumes, which total some 590 pages, can be found at https://www.solardynllc.com/csp-plant-technologies. One of the principal topics in the report is the use of functional or prescriptive specifications. Functional specifications describe what the equipment needs to do, consistent with the minimum legal requirements of the local jurisdictions. The details of how this is to be accomplished is developed by the engineering contractor. Prescriptive specifications, which are developed by the Owner, prescribe to the engineering contractor how the functional requirements are to be met. This arrangement ensures that the favorable experience from a previous project is repeated. One example is the design code for the hot salt tank in central receiver projects. The closest design basis is API Standard 650 Welded Steel Tanks for Oil Storage. However, the maximum design temperature in API 650 is 260 °C. As such, solar projects have typically adopted a hybrid Code approach, in which allowable material stresses are taken from ASME Section II Materials. Further, since the tanks experience daily changes in temperature and in (static) pressure, and since portions of the tank can operate at stresses beyond the elastic range, the low cycle fatigue life of the tank is conducted using the rules of Section VIII Division 2. However, in a recent study by NREL, the principal damage mechanism was identified as creep rather than fatigue. Further, design stresses permitted under Section VIII Division 2, corresponding to a fatigue life of 30 years, result in projected creep lifetimes of only 2 to 5 years. An alternate design approach, prescribed by the Owner, would be based on Code sections intended for high temperature service in the creep regime. A candidate is Section III Division 5. Granted, this is a nuclear code section, and it’s use would not likely be mandated by local jurisdictions. However, the effects of creep have been deemed to be of sufficient importance that one nuclear project developer, and one central receiver project developer, have stipulated in the tank design specification that the equipment be designed to the requirements of Section III Division 5.

14 SOLAR ENERGY↗
DOE OSTI2022

Removal of Non-Specifically Bound Proteins Using Rayleigh Waves Generated on ST-Quartz Substrates

Label-free biosensors are plagued by the issue of non-specific protein binding which negatively affects sensing parameters such as sensitivity, selectivity, and limit-of-detection. In the current work, we explore the possibility of using the Rayleigh waves in ST-Quartz devices to efficiently remove non-specifically bound proteins via acoustic streaming. A coupled-field finite element (FE) fluid structure interaction (FSI) model of a surface acoustic wave (SAW) device based on ST-Quartz substrate in contact with a liquid loading was first used to predict trends in forces related to SAW-induced acoustic streaming. Based on model predictions, it is found that the computed SAW body force is sufficient to overcome adhesive forces between particles and a surface while lift and drag forces prevent reattachment for a range of SAW frequencies. We further performed experiments to validate the model predictions and observe that the excitation of Rayleigh SAWs removed non-specifically bound (NSB) antigens and antibodies from sensing and non-sensing regions, while rinsing and blocking agents were ineffective. An amplified RF signal applied to the device input disrupted the specific interactions between antigens and their capture antibody as well. ST-quartz allows propagation of Rayleigh and leaky SH-SAW waves in orthogonal directions. Thus, the results reported here could allow integration of three important biosensor functions on a single chip, i.e., removal of non-specific binding, mixing, and sensing in the liquid phase.

59 BASIC BIOLOGICAL SCIENCES↗