SEARCH · Engineering Papers

Results for “DNA, Plant”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 325 records · Page 18

All sources NASA NTRS DOE OSTI

NASA NTRS2020

Predicting Cell Death and Mutation Frequency for a Wide Spectrum of LET by Assuming DNA Break Clustering Inside Repair Domains

Cosmic radiation, which is composed of high charged and energy (HZE) particles, is responsible for cell death and mutation, which may be involved in cancer induction. Mutations are consequences of mis-repaired DNA breaks – especially double-strand breaks (DSBs) – that induce inter- and intra-chromosomal rearrangements (translocations, deletions, inversion). In this study, a computer simulation model is used to investigate the clustering of DSBs in repair domains, previously evidenced by our group in human breast cells [1]. This model is calibrated with experimental data measuring persistent 53BP1 radiation-induced foci (RIF) and is used to explain the high relative biological effectiveness (RBE) of HZE for both cell death and DNA mutation frequencies. We first validate our DSB cluster model using a new track structure model deployed on a simple geometrical configuration for repair domains in the nucleus; then we extend the scope from cell death to mutation induction. This work suggests that mechanism based on DSB repair process can explain several biological effects induced by HZE particles on different type of living cells

Plante, Ianik↗

NASA NTRSDate not supplied

Predicting cell death and mutation frequency for a wide spectrum of LET and across cell lines from DNA break clustering inside repair domains

Cosmic radiation, which is composed of high charged and energy (HZE) particles, is responsible for cell death and mutation, which may be involved in cancer induction. Mutations are consequences of mis-repaired DNA breaks – especially double-strand breaks (DSBs) – that induce inter- and intra-chromosomal rearrangements (translocations, deletions, inversion). In this study, a computer simulation model is used to investigate the clustering of DSBs in repair domains, previously evidenced by our group in human breast cells. This model is calibrated with experimental data measuring persistent 53BP1 radiation-induced foci (RIF) and is used to explain the high relative biological effectiveness (RBE) of HZE for both cell death and DNA mutation frequencies. We first validate our DSB cluster model using a new track structure model deployed on a simple geometrical configuration for repair domains in the nucleus; then we extend the scope from cell death to mutation induction. This work suggests that mechanism based on DSB repair process can explain several biological effects induced by HZE particles on different type of living cells.

Ianik Plante↗

NASA NTRSDate not supplied

A Lunar Ground Truth of Microbes that are Integral to Sustaining Biological Life Support Systems

A lunar outpost such as Gateway or a Mars transit vehicle will use a semi-closed to closed loop biological life support system (BLSS) adapted for microgravity and high levels of radiation. A moon habitat will likely exist under partial gravity conditions and sustained levels of high radiation as a semi-closed loop system able to get resources from Earth via Gateway. Additionally, the moon will act as a closed-loop testbed for Mars habitat operations and will employ various elements of in situ resource utilization (ISRU). Perhaps the longest running BLSS collective study to date is that of the European MELiSSA (Micro Ecological Life Support System Alternative) project, a circular life support system, established to gain knowledge on regenerative systems aimed at the highest degree of autonomy to produce food, water and oxygen from mission wastes. This setup has evaluated the use of discrete microbial compartments and a higher plant compartment to carry out the necessary life support functions to support crew. Such compartments utilize thermophilic anaerobes to break down human and inedible plant wastes, photoheterotrophic bacteria that can further metabolize volatile fatty acids, nitrifying bacteria that can convert ammonium to plant and microalgae available nitrates, and photoautotrophic bacteria and higher plants which will convert carbon dioxide to oxygen, purify water, and provide food for human consumption. This being the most advanced BLSS model example to date -aside from the Yuegong-1, Chinese Lunar Palace- with the most defined compartment composition, and the assumption that other BLSSs will build upon such models, it becomes relevant to study the effects of the lunar environment upon the microbes that are integral to a BLSS. In ramping up to advanced stage BLSS systems, relatively simple experiments can be conducted on Artemis missions using continuous culturing and sampling of the model microbes, subsequently subjected to DNA sequencing for mutational analysis monitoring and chemical analysis to assess the sustained ability to carry out their hallmark biochemical processes efficiently. A suite of microbes should be assessed, prioritizing those with the duel capacity to be utilized in an BLSS and the ability to biochemically facilitate ISRU goals, such as the ability to transform the biogeochemistry of Moon or Martian regolith into materials that can support crop growth or extract elements of industrial significance such as aluminum or iron.

Biological Life Support Systems↗

DOE OSTI2022

Delimiting the cryptic diversity and host preferences of Sycophila parasitoid wasps associated with oak galls using phylogenomic data

Abstract Cryptic species diversity is a major challenge regarding the species‐rich community of parasitoids attacking oak gall wasps due to a high degree of sexual dimorphism, morphological plasticity, small size and poorly known biology. As such, we know very little about the number of species present, nor the evolutionary forces responsible for generating this diversity. One hypothesis is that trait diversity in the gall wasps, including the morphology of the galls they induce, has evolved in response to selection imposed by the parasitoid community, with reciprocal selection driving diversification of the parasitoids. Using a rare, continental‐scale data set of Sycophila parasitoid wasps reared from 44 species of cynipid galls from 18 species of oak across the USA, we combined mitochondrial DNA barcodes, ultraconserved elements (UCEs), morphological and natural history data to delimit putative species. Using these results, we generate the first large‐scale assessment of ecological specialization and host association in this species‐rich group, with implications for evolutionary ecology and biocontrol. We find most Sycophila target specific subsets of available cynipid host galls with similar morphologies, and generally attack larger galls. Our results suggest that parasitoid wasps such as Sycophila have adaptations allowing them to exploit particular host trait combinations, while hosts with contrasting traits are resistant to attack. These findings support the tritrophic niche concept for the structuring of plant–herbivore–parasitoid communities.

Zhang, Yuanmeng M.↗

DOE OSTI2021

In vitro effects of cannabidiol and its main metabolites in mouse and human Sertoli cells

Cannabidiol (CBD) is a major cannabinoid present in extracts of the plant Cannabis sativa (marijuana). While the therapeutic effects of CBD on epilepsy have been demonstrated, less is understood regarding its potential adverse effects. Recent studies revealed that CBD induced toxicity in the male reproductive system of animal models. In this study, we used TM4, an immortalized mouse Sertoli cell line, and primary human Sertoli cells to evaluate the toxicities of CBD and its main metabolites, 7-carboxy-CBD and 7-hydroxy-CBD. CBD induced concentration- and time-dependent cytotoxicity in mouse and human Sertoli cells, which mainly resulted from the inhibition of the G1/S-phase cell cycle transition. CBD also inhibited DNA synthesis and downregulated key cell cycle proteins. Moreover, CBD reduced the mRNA and protein levels of a functional marker, Wilms’ tumor 1. Similar to CBD, 7-carboxy-CBD and 7-hydroxy-CBD inhibited cellular proliferation and decreased DNA synthesis. 7-Carboxy-CBD was less cytotoxic than CBD, while 7-hydroxy-CBD showed comparable cytotoxicity to CBD in both mouse and human Sertoli cells. Compared to mouse Sertoli cells, CBD, 7-hydroxy-CBD, and 7-carboxy-CBD were more cytotoxic in human Sertoli cells. Finally, our results indicate that CBD and its main metabolites can inhibit cell proliferation in mouse and human Sertoli cells.

59 BASIC BIOLOGICAL SCIENCES↗

NASA NTRS2014

Overview of NASARTI (NASA Radiation Track Image) Program: Highlights of the Model Improvement and the New Results

This presentation summarizes several years of research done by the co-authors developing the NASARTI (NASA Radiation Track Image) program and supporting it with scientific data. The goal of the program is to support NASA mission to achieve a safe space travel for humans despite the perils of space radiation. The program focuses on selected topics in radiation biology that were deemed important throughout this period of time, both for the NASA human space flight program and to academic radiation research. Besides scientific support to develop strategies protecting humans against an exposure to deep space radiation during space missions, and understanding health effects from space radiation on astronauts, other important ramifications of the ionizing radiation were studied with the applicability to greater human needs: understanding the origins of cancer, the impact on human genome, and the application of computer technology to biological research addressing the health of general population. The models under NASARTI project include: the general properties of ionizing radiation, such as particular track structure, the effects of radiation on human DNA, visualization and the statistical properties of DSBs (DNA double-strand breaks), DNA damage and repair pathways models and cell phenotypes, chromosomal aberrations, microscopy data analysis and the application to human tissue damage and cancer models. The development of the GUI and the interactive website, as deliverables to NASA operations teams and tools for a broader research community, is discussed. Most recent findings in the area of chromosomal aberrations and the application of the stochastic track structure are also presented.

Ponomarev, Artem L.↗

DOE OSTI2020

Niche Partitioning of Microbial Communities at an Ancient Vitrified Hillfort: Implications for Vitrified Radioactive Waste Disposal

A pre-Viking era vitrified hillfort, Broborg, provides a habitat analogue for disposed radioactive waste glass and shows strong niche partitioning among the organisms involved in glass alteration. Microbes cannot be eliminated from radioactive waste disposal facilities and the consequences of bio-colonization must be understood. We use Broborg as a model system to inform what microbial processes might influence long-term radioactive waste glass durability by examining anthropogenic glass that has been subjected to bio-colonization for over 1,500 years. Scanning electron microscopy (SEM) images reveal the surficial biofilm structure, and chemical/mineralogy analysis in combination with deoxyribonucleic acid (DNA) sequencing of samples from the vitrified substrate, the adjacent soil, and the general topsoil provide insight into niche partitioning. The ancient glass niche supports a unique microbial community of bacteria, fungi, and protists that manifests the species response to local geochemical and mineralogical conditions. Communities from the geochemical niche associated with the glass are distinct and less diverse than soil communities. The microbiome of the glass and adjacent soil are dominated by lichens, lichen-associated microorganisms, and other epilithic, endolithic, and epigeic organisms. Pseudomonads dominate the prokaryotic communities on the vitrified material, but not the adjacent soil. In contrast, the general topsoil communities are enriched in plant rhizosphere organisms. Taxa associated with vitrification have bio-corrosive properties that could be detrimental to glass durability, including silicate mineral dissolution, extraction of essential elements, secretion of geochemically reactive organic acids, and dissolution induced by improved water retention. However, these stable long-term biofilms also possess a homeostatic function that could limit glass alteration. Overall, this study demonstrates the potential impacts that microbial colonization and niche partitioning can have on glass alteration and subsequent release of radionuclides from a disposal facility for vitrified radioactive waste.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2021

Discovery of photosynthesis genes through whole-genome sequencing of acetate-requiring mutants of Chlamydomonas reinhardtii

Large-scale mutant libraries have been indispensable for genetic studies, and the development of next-generation genome sequencing technologies has greatly advanced efforts to analyze mutants. In this work, we sequenced the genomes of 660 Chlamydomonas reinhardtii acetate-requiring mutants, part of a larger photosynthesis mutant collection previously generated by insertional mutagenesis with a linearized plasmid. We identified 554 insertion events from 509 mutants by mapping the plasmid insertion sites through paired-end sequences, in which one end aligned to the plasmid and the other to a chromosomal location. Nearly all (96%) of the events were associated with deletions, duplications, or more complex rearrangements of genomic DNA at the sites of plasmid insertion, and together with deletions that were unassociated with a plasmid insertion, 1470 genes were identified to be affected. Functional annotations of these genes were enriched in those related to photosynthesis, signaling, and tetrapyrrole synthesis as would be expected from a library enriched for photosynthesis mutants. Systematic manual analysis of the disrupted genes for each mutant generated a list of 253 higher-confidence candidate photosynthesis genes, and we experimentally validated two genes that are essential for photoautotrophic growth, CrLPA3 and CrPSBP4 . The inventory of candidate genes includes 53 genes from a phylogenomically defined set of conserved genes in green algae and plants. Altogether, 70 candidate genes encode proteins with previously characterized functions in photosynthesis in Chlamydomonas , land plants, and/or cyanobacteria; 14 genes encode proteins previously shown to have functions unrelated to photosynthesis. Among the remaining 169 uncharacterized genes, 38 genes encode proteins without any functional annotation, signifying that our results connect a function related to photosynthesis to these previously unknown proteins. This mutant library, with genome sequences that reveal the molecular extent of the chromosomal lesions and resulting higher-confidence candidate genes, will aid in advancing gene discovery and protein functional analysis in photosynthesis.

59 BASIC BIOLOGICAL SCIENCES↗

NASA NTRS1994

Mutagenic effects of heavy ion radiation in plants

Genetic and developmental effects of heavy ions in maize and rice were investigated. Heavy particles with various charges and energies were accelerated at the BEVALAC. The frequency of occurrence of white-yellow stripes on leaves of plants developed from irradiated maize seeds increased linearly with dose, and high Linear Energy Transfer (LET) heavy charged particles, e.g., neon, argon, and iron, were 2-12 times as effective as gamma rays in inducing this type of mutation. The effectiveness of high-LET heavy ion in (1) inhibiting rice seedling growth, (2) reducing plant fertility, (3) inducing chromosome aberration and micronuclei in root tip cells and pollen mother cells of the first generation plants developed from exposed seeds, and (4) inducing mutation in the second generation, were greater than that of low-LET gamma rays. All effects observed were dose-dependent; however, there appeared to be an optimal range of doses for inducing certain types of mutation, for example, for argon ions (400 MeV/u) at 90-100 Gy, several valuable mutant lines with favorable characters, such as semidwarf, early maturity and high yield ability, were obtained. Experimental results suggest that the potential application of heavy ions in crop improvement is promising. Restriction-fragment-length-polymorphism (RFLP) analysis of two semidwarf mutants induced by argon particles revealed that large DNA alterations might be involved in these mutants.

Mei, M.↗

NASA NTRS2018

Computational Model Prediction and Biological Validation Using Simplified Mixed Field Exposures for the Development of a GCR Reference Field

The yield of chromosomal aberrations has been shown to increase in the lymphocytes of astronauts after long-duration missions of several months in space. Chromosome exchanges, especially translocations, are positively correlated with many cancers and are therefore a potential biomarker of cancer risk associated with radiation exposure. Although extensive studies have been carried out on the induction of chromosomal aberrations by low- and high-LET radiation in human lymphocytes, fibroblasts, and epithelial cells exposed in vitro, there is a lack of data on chromosome aberrations induced by low dose-rate chronic exposure and mixed field beams such as those expected in space. Chromosome aberration studies at NSRL will provide the biological validation needed to extend the computational models over a broader range of experimental conditions (more complicated mixed fields leading up to the galactic cosmic rays (GCR) simulator), helping to reduce uncertainties in radiation quality effects and dose-rate dependence in cancer risk models. These models can then be used to answer some of the open questions regarding requirements for a full GCR reference field, including particle type and number, energy, dose rate, and delivery order. In this study, we designed a simplified mixed field beam with a combination of proton, helium, oxygen, and iron ions with shielding or proton, helium, oxygen, and titanium without shielding. Human fibroblasts cells were irradiated with these mixed field beam as well as each single beam with acute and chronic dose rate, and chromosome aberrations (CA) were measured with 3-color fluorescent in situ hybridization (FISH) chromosome painting methods. Frequency and type of CA induced with acute dose rate and chronic dose rates with single and mixed field beam will be discussed. A computational chromosome and radiation-induced DNA damage model, BDSTRACKS (Biological Damage by Stochastic Tracks), was updated to simulate various types of CA induced by acute exposures of the mixed field beams used for the experiments. The chromosomes were simulated by a polymer random walk algorithm with restrictions to their respective domains in the nucleus [1]. The stochastic dose to the nucleus was calculated with the code RITRACKS [2]. Irradiation of a target volume by a mixed field of ions was implemented within RITRACKs, and the fields of ions can be delivered over specific periods of time, allowing the simulation of dose-rate effects. Similarly, particles of various types and energies extracted from a pre-calculated spectra of galactic cosmic rays (GCR) can be used in RITRACKS. The number and spatial location of DSBs (DNA double-strand breaks) were calculated in BDSTRACKS using the simulated chromosomes and local (voxel) dose. Assuming that DSBs led to chromosome breaks, and simulating the rejoining of damaged chromosomes occurring during repair, BDSTRACKS produces the yield of various types of chromosome aberrations as a function of time (only final yields are presented). A comparison between experimental and simulation results will be shown.

Hada, M.↗

DOE OSTI2021

Evolutionary innovations through gain and loss of genes in the ectomycorrhizal Boletales

Summary We aimed to identify genomic traits of transitions to ectomycorrhizal ecology within the Boletales by comparing the genomes of 21 symbiotrophic species with their saprotrophic brown‐rot relatives. Gene duplication rate is constant along the backbone of Boletales phylogeny with large loss events in several lineages, while gene family expansion sharply increased in the late Miocene, mostly in the Boletaceae. Ectomycorrhizal Boletales have a reduced set of plant cell‐wall‐degrading enzymes (PCWDEs) compared with their brown‐rot relatives. However, the various lineages retain distinct sets of PCWDEs, suggesting that, over their evolutionary history, symbiotic Boletales have become functionally diverse. A smaller PCWDE repertoire was found in Sclerodermatineae. The gene repertoire of several lignocellulose oxidoreductases (e.g. laccases) is similar in brown‐rot and ectomycorrhizal species, suggesting that symbiotic Boletales are capable of mild lignocellulose decomposition. Transposable element (TE) proliferation contributed to the higher evolutionary rate of genes encoding effector‐like small secreted proteins, proteases, and lipases. On the other hand, we showed that the loss of secreted CAZymes was not related to TE activity but to DNA decay. This study provides novel insights on our understanding of the mechanisms influencing the evolutionary diversification of symbiotic boletes.

Wu, Gang↗

DOE OSTI2025

A novel regulator of the fungal phosphate starvation response revealed by transcriptional profiling and DNA affinity purification sequencing

Cells must accurately sense and respond to nutrients to compete for resources and establish growth. Phosphate is a critical nutrient source necessary for signaling, energy metabolism, and synthesis of nucleic acids, phospholipids, and cellular metabolites. During phosphate limitation, fungi import phosphate from the environment and liberate phosphate from phosphate-containing molecules in the cell. In the model filamentous fungus Neurospora crassa, the phosphate starvation response is regulated by the conserved transcription factor NUC-1. The activity of NUC-1 is repressed by a complex of the cyclin-dependent kinase MDK-1 and the cyclin PREG when phosphate is plentiful. When phosphate is limiting, NUC-1 repression by MDK-1/PREG is relieved by the cyclin-dependent kinase inhibitor NUC-2. We investigated the global response of N. crassa to phosphate starvation. During phosphate starvation, NUC-1 directly activated the expression of genes encoding phosphatases, nucleases, and a phosphate transporter and directly repressed genes associated with the ribosome. Additionally, NUC-1 indirectly activated the expression of an uncharacterized transcription factor, which we named nuc-3. NUC-3 directly repressed the expression of genes involved in phosphate acquisition and liberation after an extended period of phosphate starvation. Additionally, NUC-3 directly repressed the expression of the cyclin-dependent kinase inhibitor nuc-2. Thus, through the combination of NUC-3 direct repression of genes in the phosphate starvation response and nuc-2, an activator of the phosphate starvation response, NUC-3 serves to act as a brake on the phosphate starvation response after an extended period of phosphate starvation. This braking mechanism could reduce transcription, a phosphate-intensive process, under conditions of extended phosphate limitation.IMPORTANCEFungi have evolved regulatory networks to respond to available nutrients. Phosphate is often a limiting nutrient for fungi that is critical for many cellular functions, including nucleic acid and phospholipid biosynthesis, cell signaling, and energy metabolism. The fungal response to phosphate limitation is important in interactions with plants and animals. We investigated the global transcriptional response to phosphate starvation and the role of a major transcriptional regulator, NUC-1, in the model filamentous fungus Neurospora crassa. Our data show that NUC-1 is a bifunctional transcription factor that directly activates phosphate acquisition genes, while directly repressing genes associated with phosphate-intensive processes. NUC-1 indirectly regulates an uncharacterized transcription factor, which we named nuc-3. NUC-3 directly represses phosphate acquisition genes and nuc-2, an activator of the phosphate starvation response, during extended periods of phosphate starvation. Thus, NUC-3 acts as a brake on the phosphate starvation response to reduce phosphate-intensive activities, like transcriptional activation, when phosphate starvation persists.

DNA affinity purification sequencing↗

NASA NTRS2019

Biological CubeSats: What Have We Learned so Far and What Is Next?

Since Apollo 17 in 1972, NASA has sent no humans or other biological organisms outside of Earth's protective magnetosphere. Recently, NASA has set its sights on human exploration in deep space, with an ambitous plan to put astronauts back on the Moon by 2024 and to eventually land human missions on Mars. Such missions will require significant countermeasures, likely both technological and biomedical, to protect biology from chronic radiation exposure. CubeSats can inform these countermeasures by querying relevant space environments with model organisms.NASA has launched five biological CubeSat missions into low-Earth orbit (LEO). GeneSat-1 was launched in 2006 to study gene expression and increase our knowledge of how spaceflight affects microbes. Similar life-support technologies were then used in PharmaSat and O/OREOS, which launched in 2009 and 2010, respectively. PharmaSat contained optical systems to examine how yeast cells responded to an antifungal treatment. One of O/OREOS payloads, SESLO (Space Environment Survivability of Living Organisms), housed dormant microorganisms, which were rehydrated on orbit to track alterations to growth and metabolism induced by microgravity and radiation. In 2014, NASA launched SporeSat to study the mechanisms of plant cell gravity sensing using lab-on-a-chip devices. Most recently, in 2017, NASA launched EcAMSat (E. coli AntiMicrobial Satellite), which investigated the effects of microgravity on antibiotic resistance of a pathogenic bacterium. Each one of these missions increased our understanding of the biological effects of spaceflight in LEO, while refining technologies and imparting valuable lessons to the next generation of CubeSats.CubeSats housing translational biological models are therefore ideal for defining the hazards of deep space travel, as they can provide critical data over relevant durations. BioSentinel, a next-generation deep-space CubeSat, is planned to launch as a secondary payload on Artemis 1 in 2020. BioSentinel will study the DNA damage response to deep space radiation in yeast.

Santa Maria, Sergio R.↗

DOE OSTI2025

Community‐Level Metabolic Shifts Following Land Use Change in the Amazon Rainforest Identified by a Supervised Machine Leaning Approach

ABSTRACT The Amazon rainforest has been subjected to high rates of deforestation, mostly for pasturelands, over the last few decades. This change in plant cover is known to alter the soil microbiome and the functions it mediates, but the genomic changes underlying this response are still unresolved. In this study, we used a combination of deep shotgun metagenomics complemented by a supervised machine learning approach to compare the metabolic strategies of tropical soil microbial communities in pristine forests and long‐term established pastures in the Amazon. Machine learning‐derived metagenome analysis indicated that microbial community structures (bacteria, archaea and viruses) and the composition of protein‐coding genes were distinct in each plant cover type environment. Forest and pasture soils had different genomic diversities for the above three taxonomic groups, characterised by their protein‐coding genes. These differences in metagenome profiles in soils under forests and pastures suggest that metabolic strategies related to carbohydrate and energy metabolisms were altered at community level. Changes were also consistent with known modifications to the C and N cycles caused by long‐term shifts in aboveground vegetation and were also associated with several soil physicochemical properties known to change with land use, such as the C/N ratio, soil temperature and exchangeable acidity. In addition, our analysis reveals that these alterations in land use can also result in changes to the composition and diversity of the soil DNA virome. Collectively, our study indicates that soil microbial communities shift their overall metabolic strategies, driven by genomic alterations observed in pristine forests and long‐term established pastures with implications for the C and N cycles.

carbon and nitrogen cycles↗

NASA NTRSDate not supplied

Stress-Activated Positive Holes (O− in a Matrix of O2–) Cause DNA Damage in Surface-Dwelling Organisms: Unveiling Mutation-Induced Secrets of Nature

Peroxy defects consist of pairs of tightly bonded oxygen anions in the –1 valence state such as in O3X/OO\YO3 with X, Y = Si4+, Al3+ etc. They commonly occur in igneous, metamorphic and many sedimentary rocks. When such rocks are stressed by tectonic forces, peroxy defects break up, releasing highly mobile electronic charge carriers: defect electrons in the O2– sublattice, i.e. unbound O–, known as “positive holes”, h•. The h• can flow out of stressed rock volumes, spreading far and wide, causing electric currents and electrochemical reactions. This study explores how the h• impact the electron flow in the electron transport chain (ETC) of organisms on the surface of rocks such as gabbro and granite. We found that, by forming hydroxyl radicals and superoxide anions, the h• disrupt the in vivo coordination of reduction-oxidation reactions that are essential for the timing of the redox cycle. Our observations show that stress activation of h• delays the sprouting of certain plant seeds and impedes the growth of yeast cultures, Saccharomyces cerevisiae. The h• induce mutations and affect plant development as evidenced by reduced stem length and leaf size. At the same time, the h• serve as a source of abiotic oxidation, capable of forming various organic compounds in situ. Through the generation of radical species that create new carbon-carbon bonds the h• facilitate the abiotic synthesis of hydrocarbons and other organic molecules essential to life, including porphyrins. Our findings highlight the intricate interplay between positive holes, redox timing, and biological processes, revealing their significant role in influencing the growth and development of organisms in tectonically stressed crustal environments. Understanding these effects enhances our broader comprehension of redox biology and the influence of environmental factors on cellular development in natural settings.

astrobiology↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2020

Chapter 6: An Improved Leaf Protoplast System for Highly Efficient Transient Expression in Switchgrass (Panicum virgatum L.)

As a robust perennial C4-type monocot plant and a native species to North America, switchgrass (Panicum virgatum) has been evaluated and designated as a strong candidate bioenergy crop by the U.S. DOE. Although genetic modifications of switchgrass have been used to successfully reduce the recalcitrance of switchgrass biomass for biofuel production, the generation of transgenic switchgrass is still a slow and laborious process. A transient protoplast system can provide an excellent platform to accelerate the selection of genes-of-interest for tailoring switchgrass biomass. However, partially due to the lack of the complete genomic information, the attempts to optimize the transient protoplast system for switchgrass remain scarce. In this chapter, we provide an improved protocol for switchgrass protoplast isolation, increased transformation efficiency using CsCl gradient ultracentrifugation-derived plasmid DNA and extended application of the transient switchgrass protoplast system to analyze protein expression using western blot.

BASIC BIOLOGICAL SCIENCES,BIOMASS FUELS↗

NASA NTRS1998

A 5.8S nuclear ribosomal RNA gene sequence database: applications to ecology and evolution

We complied a 5.8S nuclear ribosomal gene sequence database for animals, plants, and fungi using both newly generated and GenBank sequences. We demonstrate the utility of this database as an internal check to determine whether the target organism and not a contaminant has been sequenced, as a diagnostic tool for ecologists and evolutionary biologists to determine the placement of asexual fungi within larger taxonomic groups, and as a tool to help identify fungi that form ectomycorrhizae.

Databases, Factual↗