Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “Cell structure identification”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 307 records · Page 17
All sourcesNASA NTRSDOE OSTI
DOE OSTI2018

Identification of a selective inhibitor of human monocarboxylate transporter 4

Highlights: • hMCT4 transporter mediates the transport of metabolites such as l-lactate and pyruvate. • 5-ETZ, a bioisostere of propionate, is recognized by hMCT1 and hMCT4. • Fibrates, a group of isobutyrate derivatives, selectively inhibit hMCT4. • Bindarit might be the first-identified potent and selective inhibitor of hMCT4. The human monocarboxylate transporters (hMCTs/SLC16As) mediate the uptake of various monocarboxylates. Several isoforms of hMCTs are expressed in cancerous tissue as well as in normal tissue. In cancerous tissue, hypoxia induces the expression of hMCT4, which transports the energetic metabolite l-lactate across the plasma membrane. Since hMCT4 is involved in pH regulation and the transport of l-lactate in cancer cells, an hMCT4 inhibitor could function as an anticancer agent. Although several non specific hMCT inhibitors have been developed, a selective hMCT4 inhibitor has not yet been identified. The aim of this study was therefore to identify a selective hMCT4 inhibitor for use as a pharmacological tool for studying hMCT4. The heterologous expression system of the Xenopus oocyte was used to assess the effects of test compounds on hMCT4, whereupon isobutyrate derivatives, fibrates, and bindarit (2-[(1-benzyl-1H-indazol-3-yl)methoxy]-2-methylpropanoic acid) were demonstrated to exhibit selective inhibitory effects against this transporter. It is suggested that the structure formed from the joining of an isobutyrate moiety and two aromatic rings by appropriate linkers is important for acquiring the selective hMCT4-inhibiting activity. These findings provide novel insights into the ligand recognition of hMCT4, and contribute to the development of novel anticancer agents.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2022

Swimming and the human microbiome at the intersection of sports, clinical, and environmental sciences: A scoping review of the literature

The human microbiota is comprised of more than 10–100 trillion microbial taxa and symbiotic cells. Two major human sites that are host to microbial communities are the gut and the skin. Physical exercise has favorable effects on the structure of human microbiota and metabolite production in sedentary subjects. Recently, the concept of “athletic microbiome” has been introduced. To the best of our knowledge, there exists no review specifically addressing the potential role of microbiomics for swimmers, since each sports discipline requires a specific set of techniques, training protocols, and interactions with the athletic infrastructure/facility. Therefore, to fill in this gap, the present scoping review was undertaken. Four studies were included, three focusing on the gut microbiome, and one addressing the skin microbiome. It was found that several exercise-related variables, such as training volume/intensity, impact the athlete’s microbiome, and specifically the non-core/peripheral microbiome, in terms of its architecture/composition, richness, and diversity. Swimming-related power-/sprint- and endurance-oriented activities, acute bouts and chronic exercise, anaerobic/aerobic energy systems have a differential impact on the athlete’s microbiome. Therefore, their microbiome can be utilized for different purposes, including talent identification, monitoring the effects of training methodologies, and devising ad hoc conditioning protocols, including dietary supplementation. Microbiomics can be exploited also for clinical purposes, assessing the effects of exposure to swimming pools and developing potential pharmacological strategies to counteract the insurgence of skin infections/inflammation, including acne. In conclusion, microbiomics appears to be a promising tool, even though current research is still limited, warranting, as such, further studies.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Early Drug Discovery and Development of Novel Cancer Therapeutics Targeting DNA Polymerase Eta (POLH)

Polymerase eta (or Pol η or POLH) is a specialized DNA polymerase that is able to bypass certain blocking lesions, such as those generated by ultraviolet radiation (UVR) or cisplatin, and is deployed to replication foci for translesion synthesis as part of the DNA damage response (DDR). Inherited defects in the gene encoding POLH (a.k.a., XPV) are associated with the rare, sun-sensitive, cancer-prone disorder, xeroderma pigmentosum, owing to the enzyme’s ability to accurately bypass UVR-induced thymine dimers. In standard-of-care cancer therapies involving platinum-based clinical agents, e.g., cisplatin or oxaliplatin, POLH can bypass platinum-DNA adducts, negating benefits of the treatment and enabling drug resistance. POLH inhibition can sensitize cells to platinum-based chemotherapies, and the polymerase has also been implicated in resistance to nucleoside analogs, such as gemcitabine. POLH overexpression has been linked to the development of chemoresistance in several cancers, including lung, ovarian, and bladder. Co-inhibition of POLH and the ATR serine/threonine kinase, another DDR protein, causes synthetic lethality in a range of cancers, reinforcing that POLH is an emerging target for the development of novel oncology therapeutics. Using a fragment-based drug discovery approach in combination with an optimized crystallization screen, we have solved the first X-ray crystal structures of small novel drug-like compounds, i.e., fragments, bound to POLH, as starting points for the design of POLH inhibitors. The intrinsic molecular resolution afforded by the method can be quickly exploited in fragment growth and elaboration as well as analog scoping and scaffold hopping using medicinal and computational chemistry to advance hits to lead. An initial small round of medicinal chemistry has resulted in inhibitors with a range of functional activity in an in vitro biochemical assay, leading to the rapid identification of an inhibitor to advance to subsequent rounds of chemistry to generate a lead compound. Importantly, our chemical matter is different from the traditional nucleoside analog-based approaches for targeting DNA polymerases.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2014

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2021

Potent Antiviral Activity against HSV-1 and SARS-CoV-2 by Antimicrobial Peptoids

Viral infections, such as those caused by Herpes Simplex Virus-1 (HSV-1) and SARS-CoV-2, affect millions of people each year. However, there are few antiviral drugs that can effectively treat these infections. The standard approach in the development of antiviral drugs involves the identification of a unique viral target, followed by the design of an agent that addresses that target. Antimicrobial peptides (AMPs) represent a novel source of potential antiviral drugs. AMPs have been shown to inactivate numerous different enveloped viruses through the disruption of their viral envelopes. However, the clinical development of AMPs as antimicrobial therapeutics has been hampered by a number of factors, especially their enzymatically labile structure as peptides. We have examined the antiviral potential of peptoid mimics of AMPs (sequence-specific N-substituted glycine oligomers). These peptoids have the distinct advantage of being insensitive to proteases, and also exhibit increased bioavailability and stability. Our results demonstrate that several peptoids exhibit potent in vitro antiviral activity against both HSV-1 and SARS-CoV-2 when incubated prior to infection. In other words, they have a direct effect on the viral structure, which appears to render the viral particles non-infective. Visualization by cryo-EM shows viral envelope disruption similar to what has been observed with AMP activity against other viruses. Furthermore, we observed no cytotoxicity against primary cultures of oral epithelial cells. These results suggest a common or biomimetic mechanism, possibly due to the differences between the phospholipid head group makeup of viral envelopes and host cell membranes, thus underscoring the potential of this class of molecules as safe and effective broad-spectrum antiviral agents. We discuss how and why differing molecular features between 10 peptoid candidates may affect both antiviral activity and selectivity.

60 APPLIED LIFE SCIENCES↗
NASA NTRS2007

Design and Simulation of a MEMS Structure for Electrophoretic and Dielectrophoretic Separation of Particles by Contactless Electrodes

Rapid identification of pathogenic bacterial species is an important factor in combating public health problems such as E. coli contamination. Food and waterborne pathogens account for sickness in 76 million people annually (CDC). Diarrheagenic E. coli is a major source of gastrointestinal illness. Severe sepsis and Septicemia within the hospital environment are also major problems. 75 1,000 cases annually with a 30-50% mortality rate (Crit Care Med, July '01, Vol. 29, 1303-10). Patient risks run the continuum from fever to organ failure and death. Misdiagnosis or inappropriate treatment increases mortality. There exists a need for rapid screening of samples for identification of pathogenic species (Certain E. coli strains are essential for health). Critical to the identification process is the ability to isolate analytes of interest rapidly. This poster discusses novel devices for the separation of particles on the basis of the dielectric properties, mass and surface charge characteristics is presented. Existing designs involve contact between electrode surfaces and analyte medium resulting in contamination of the electrode bearing elements Two different device designs using different bulk micromachining MEMS processes (PolyMUMPS and a PyrexBIGold electrode design) are presented. These designs cover a range of particle sizes from small molecules through eucaryotic cells. The application of separation of bacteria is discussed in detail. Simulation data for electrostatic and microfluidic characteristics are provided. Detailed design characteristics and physical features of the as fabricated PolyMUMPS design are provided. Analysis of the simulation data relative to the expected performance of the devices will be provided and subsequent conclusions discussed.

Shaw, Harry C.↗
DOE OSTI2022

Polymerization of the backbone of the pectic polysaccharide rhamnogalacturonan I

Rhamnogalacturonan I (RG-I) is a major plant cell wall pectic polysaccharide defined by its repeating disaccharide backbone structure of [4)-α-d-GalA- (1,2)-α-l-Rha-(1,]. A family of RG-I:Rhamnosyltransferases (RRT) has previously been identified, but synthesis of the RG-I backbone has not been demonstrated in vitro because the identity of Rhamnogalacturonan I:Galaturonosyltransferase (RG-I:GalAT) was unknown. Here a putative glycosyltransferase, At1g28240/MUCI70, is shown to be an RG-I:GalAT. The name RGGAT1 is proposed to reflect the catalytic activity of this enzyme. When incubated together with the rhamnosyltransferase RRT4, the combined activities of RGGAT1 and RRT4 result in elongation of RG-I acceptors in vitro into a polymeric product. RGGAT1 is a member of a new GT family categorized as GT116, which does not group into existing GT-A clades and is phylogenetically distinct from the GALACTURONOSYLTRANSFERASE (GAUT) family of GalA transferases that synthesize the backbone of the pectin homogalacturonan. RGGAT1 has a predicted GT-A fold structure but employs a metal-independent catalytic mechanism that is rare among glycosyltransferases with this fold type. Furthermore, the identification of RGGAT1 and the 8-member Arabidopsis GT116 family provides a new avenue for studying the mechanism of RG-I synthesis and the function of RG-I in plants.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2019

Synthesis, molecular docking, and apoptogenic efficacy of novel N-heterocycle analogs to target B-cell lymphoma 2/X-linked inhibitors of apoptosis proteins to regress melanoma

The novel series of piperidine conjugated benzophenone analogs with amide link 11a–l were synthesized in a multistep process. The structures of these compounds were confirmed by IR, {sup 1}H, {sup 13}C, NMR, and mass spectra and also by elemental analyses. The newly synthesized molecules were screened for selectivity against cancers of different origin through cell based assay system using B16F10, A375, A549, HepG2, ACHN, and MCF7 cells. The results postulated that compound 11f with two bromo groups at the para position in rings A and E and two methyl groups at ortho position in rings B and D evokes target specific action against melanoma highlighting the importance of substituted groups. Down the line studies further inferred compound 11f evokes the apoptotic cellular event leading to cell death. Investigation of eventual mechanism revealed that compound 11f turned out to be a dual inhibitor of B-cell lymphoma-2 and X-linked inhibitors of apoptosis causing the up regulation of Bax and Bad. Further, the antiproliferative effects were mimicked in murine melanoma with similar mechanisms. Molecular docking experiments further confirmed that compound 11f possessed a superior affinity for of B-cell lymphoma-2 and X-linked inhibitors of apoptosis through strong hydrogen bonds. The study implies the identification of compound 11f with selective target against melanoma by inducing apoptogenic effect, which could be the future hope for the treatment of skin cancer.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2021

EVAP: A two-photon imaging tool to study conformational changes in endogenous Kv2 channels in live tissues

A primary goal of molecular physiology is to understand how conformational changes of proteins affect the function of cells, tissues, and organisms. Here, we describe an imaging method for measuring the conformational changes of the voltage sensors of endogenous ion channel proteins within live tissue, without genetic modification. We synthesized GxTX-594, a variant of the peptidyl tarantula toxin guangxitoxin-1E, conjugated to a fluorophore optimal for two-photon excitation imaging through light-scattering tissue. We term this tool EVAP (Endogenous Voltage-sensor Activity Probe). GxTX-594 targets the voltage sensors of Kv2 proteins, which form potassium channels and plasma membrane–endoplasmic reticulum junctions. GxTX-594 dynamically labels Kv2 proteins on cell surfaces in response to voltage stimulation. To interpret dynamic changes in fluorescence intensity, we developed a statistical thermodynamic model that relates the conformational changes of Kv2 voltage sensors to degree of labeling. We used two-photon excitation imaging of rat brain slices to image Kv2 proteins in neurons. We found puncta of GxTX-594 on hippocampal CA1 neurons that responded to voltage stimulation and retain a voltage response roughly similar to heterologously expressed Kv2.1 protein. Our findings show that EVAP imaging methods enable the identification of conformational changes of endogenous Kv2 voltage sensors in tissue.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2018

Identification of novel Amurin-2 variants from the skin secretion of Rana amurensis, and the design of cationicity-enhanced analogues

Highlights: • Three novel Amurin-2 variants were identified from the skin secretion of Rana amurensis. • Cationic-enhanced analogues show broader antimicrobial activity spectrums. • The substitution by Lys at position 4 improves the antimicrobial selectivity on E. coli. • The cell lysis ability of Amurin-2 peptides is associated with their positive charge. Rana amurensis is important in Chinese medicine as its skin secretions contain abundant bioactive peptides. Here, we have identified the antimicrobial peptide Amurin-2 and three highly-conserved variants, Amurin-2a, Amurin-2b and Amurin-2c through a combination of molecular cloning and MS/MS fragmentation sequencing. Synthetic replicates of these peptides demonstrate potent antimicrobial activity against S. aureus, whilst some have activity against C.albicans and even resistant bacterial MRSA. Furthermore, two Lys-analogues (K{sup 4}-Amurin-2 and K{sup 11}-Amurin-2) were designed to improve the bioactive function and the antimicrobial activity of K{sup 4}-Amurin-2 against E.coli was enhanced distinctly. In addition, the two modified peptides also showed more potent activity against S. aureus, C. albicans and MRSA strains. Meanwhile, these peptides showed inhibitory effect on the cell viability of several cancer cells. As a result, these structural and functional studies of Amurin-2 variants and analogues could provide insights for future antimicrobial peptide design.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2020

Benchmark Dose Analysis of DNA Damage Biomarker Responses Provides Compound Potency and Adverse Outcome Pathway Information for the Topoisomerase II Inhibitor Class of Compounds

Genetic toxicology data have traditionally been utilized for hazard identification to provide a binary call for a compound's risk. Recent advances in the scientific field, especially with the development of high‐throughput methods to quantify DNA damage, have influenced a change of approach in genotoxicity assessment. The in vitro MultiFlow® DNA Damage Assay is one such method which multiplexes γH2AX, p53, phospho‐histone H3 biomarkers into a single‐flow cytometric analysis (Bryce et al., [2016]: Environ Mol Mutagen 57:546–558). This assay was used to study human TK6 cells exposed to each of eight topoisomerase II poisons for 4 and 24 hr. Using PROAST v65.5, the Benchmark Dose approach was applied to the resulting flow cytometric datasets. With “compound” serving as covariate, all eight compounds were combined into a single analysis, per time point and endpoint. The resulting 90% confidence intervals, plotted in Log scale, were considered as the potency rank for the eight compounds. The in vitro MultiFlow data showed a maximum confidence interval span of 1Log, which indicates data of good quality. Patterns observed in the compound potency rank were scrutinized by using the expert rule‐based software program Derek Nexus, developed by Lhasa Limited. Compound sub‐classification and structural alerts were considered contributory to the potencies observed for the topoisomerase II poisons studied herein. The Topo II poison Adverse Outcome Pathway was evaluated with MultiFlow endpoints serving as Key Events. The step‐wise approach described herein can be considered as a foundation for risk assessment of compounds within a specific mode of action of interest. Environ. Mol. Mutagen. 2020. © 2020 Wiley Periodicals, Inc.

Wheeldon, Ryan P.↗
NASA NTRS2003

From Oxygen Generation to Metals Production: In Situ Resource Utilization by Molten Oxide Electrolysis

For the exploration of other bodies in the solar system, electrochemical processing is arguably the most versatile technology for conversion of local resources into usable commodities: by electrolysis one can, in principle, produce (1) breathable oxygen, (2) silicon for the fabrication of solar cells, (3) various reactive metals for use as electrodes in advanced storage batteries, and (4) structural metals such as steel and aluminum. Even so, to date there has been no sustained effort to develop such processes, in part due to the inadequacy of the database. The objective here is to identify chemistries capable of sustaining molten oxide electrolysis in the cited applications and to examine the behavior of laboratory-scale cells designed to generate oxygen and to produce metal. The basic research includes the study of the underlying high-temperature physical chemistry of oxide melts representative of lunar regolith and of Martian soil. To move beyond empirical approaches to process development, the thermodynamic and transport properties of oxide melts are being studied to help set the limits of composition and temperature for the processing trials conducted in laboratory-scale electrolysis cells. The goal of this investigation is to deliver a working prototype cell that can use lunar regolith and Martian soil to produce breathable oxygen along with metal by-product. Additionally, the process can be generalized to permit adaptation to accommodate different feedstock chemistries, such as those that will be encountered on other bodies in the solar system. The expected results of this research include: (1) the identification of appropriate electrolyte chemistries; (2) the selection of candidate anode and cathode materials compatible with electrolytes named above; and (3) performance data from a laboratory-scale cell producing oxygen and metal. On the strength of these results it should be possible to assess the technical viability of molten oxide electrolysis for in situ resource utilization on the Moon and Mars. In parallel, there may be commercial applications here on earth, such as new green technologies for metals extraction and for treatment of hazardous waste, e.g., fixing heavy metals.

Khetpal, Deepak↗
DOE OSTI2023

Assessment of ITER radiation environment during the remote-handling operation of In-Vessel components with D1SUNED

During ITER operational life, a remote-handled cask will be used to transfer In-Vessel components to the Hot Cell for maintenance, storage and decommissioning purposes. Due to the distribution of penetrations for system allocation in the facility, the radiation field of each transfer operation presents a high spatial variability; all operations must be studied independently for workers and electronics protection. In this paper, we present a fully representative approach to describe the radiation environment during the complete remote-handling scenario of In-Vessel components in the ITER facility. The impact of all relevant radiation sources during different stages of the operation is addressed. As-built structures and 2020 baseline designs are considered to produce the most detailed neutronics model of the Tokamak Complex, the 400,000-tonne civil structure hosting the tokamak, up to date. Novel capabilities of the D1SUNED code have allowed to compute the integral dose, the dose rate and the photon-induced neutron flux of both moving and static radiation sources. Time bins are included in the simulations to compute the dose rate caused by In-Vessel components at all positions along the transfer. The time evolution of the dose rate is built in video format with a 1-m resolution, especially valuable for hot-spots identification.

42 ENGINEERING↗
DOE OSTI2015

Development of III-Sb Quantum Dot Systems for High Efficiency Intermediate Band Solar Cells

This project aimed to develop solar cells that can help reduce cost per watt. This work focused on developing solar cells that utilize quantum dot (QD) nanomaterials to provide multijunction solar cell efficiency at the cost of single junction solar cell. We focused on a novel concept known as intermediate band solar cells (IBSC) where an additional energy band is inserted in a single solar cell to accommodate sub-bandgap photons absorption which otherwise are lost through transmission. The additional energy band can be achieved by growing QDs within a solar cell p-n junction. Though numerous studies have been conducted to develop such QD systems, very small improvements in solar energy conversion efficiency have been reported. This is mainly due to non-optimal material parameters such as band gap, band offset etc. In this work, we identified and developed a novel QD material system that meets the requirements of IBSC more closely than the current state-of-the-art technology. To achieve these goals, we focused on three important areas of solar cell design: band structure calculations of new materials, efficient device design for high efficiency, and development of new semiconductor materials. In this project, we focused on III-Sb materials as they possess a wide range of energy bandgaps from 0.2 eV to 2eV. Despite the difficulty involved in realizing these materials, we were successfully developed these materials through a systematic approach. Materials studied in this work are AlAsSb (Aluminum Arsenide Antimonide), InAlAs (Indium Aluminum Arsenide) and InAs (Indium Arsenide). InAs was used to develop QD layers within AlAsSb and InAlAs p-n junctions. As the QDs have very small volume, up to 30 QD layers been inserted into the p-n junction to enhance light absorption. These QD multi-stack devices helped in understanding the challenges associated with the development of quantum dot solar cells. The results from this work show that the quantum dot solar cells indeed improve the efficiency via sub-bandgap photon absorption but much lower than the expected theoretical efficiencies. Yet, these devices serve as a proof of concept and the results provide vital information for future IBSC work. With further understanding of the operation of intermediate band solar cells and the identification of less expensive materials can substantially improve the solar cell efficiency and drastically cut the cell cost thereby reducing the dollar/watt cost.

14 SOLAR ENERGY↗
DOE OSTI2014

Early Events in the Pathogenesis of Foot-and-Mouth Disease in Pigs; Identification of Oropharyngeal Tonsils as Sites of Primary and Sustained Viral Replication

A time-course study was performed to elucidate the early events of foot-and-mouth disease virus (FMDV) infection in pigs subsequent to simulated natural, intra-oropharyngeal, inoculation. The earliest detectable event was primary infection in the lingual and paraepiglottic tonsils at 6 hours post inoculation (hpi) characterized by regional localization of viral RNA, viral antigen, and infectious virus. At this time FMDV antigen was localized in cytokeratin-positive epithelial cells and CD172a-expressing leukocytes of the crypt epithelium of the paraepiglottic tonsils. De novo replication of FMDV was first detected in oropharyngeal swab samples at 12 hpi and viremia occurred at 18–24 hpi, approximately 24 hours prior to the appearance of vesicular lesions. From 12 through 78 hpi, microscopic detection of FMDV was consistently localized to cytokeratin-positive cells within morphologically characteristic segments of oropharyngeal tonsil crypt epithelium. During this period, leukocyte populations expressing CD172a, SLA-DQ class II and/or CD8 were found in close proximity to infected epithelial cells, but with little or no co-localization with viral proteins. Similarly, M-cells expressing cytokeratin-18 did not colocalize with FMDV proteins. Intra-epithelial micro-vesicles composed of acantholytic epithelial cells expressing large amounts of structural and non-structural FMDV proteins were present within crypts of the tonsil of the soft palate during peak clinical infection. These findings inculpate the paraepiglottic tonsils as the primary site of FMDV infection in pigs exposed via the gastrointestinal tract. Furthermore, the continuing replication of FMDV in the oropharyngeal tonsils during viremia and peak clinical infection with no concurrent amplification of virus occurring in the lower respiratory tract indicates that these sites are the major source of shedding of FMDV from pigs.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2017

Degradation Analysis of Field-Exposed Photovoltaic Modules with Non-Fluoropolymer-Based Backsheets

The selection of polymeric materials utilized in photovoltaic (PV) modules has changed relatively little since the inception of the PV industry, with ethylene-vinyl acetate (EVA), polyethylene terephthalate (PET), and fluoropolymer-based laminates being the most widely adopted primary components of the encapsulant and backsheet materials. The backsheet must serve to electrically insulate the solar cells and protect them from the effects of weathering. Due to continued downward pressure on cost, other polymeric materials are being formulated to withstand outdoor exposure for use in backsheets to replace either the PET film, the fluoropoymer film, or both. Because of their relatively recent deployment, less is known about their reliability and if they are durable enough to fulfill the greater than or equal to 25 year warranties of current PV modules. This work presents a degradation analysis of field-exposed modules with polyamide- and polyester-based backsheets. Modules were exposed for up to five years in different geographic locations: USA (Maryland, Ohio), China, and Italy. Surface and cross-sectional analysis included visual inspection, colorimetry, glossimetry, and Fourier-transform infrared spectroscopy. Each module experienced different types of degradation depending on the exposure site, even for the same material and module brand. For instance, the polyamide-based backsheet experienced hairline cracking and greater yellowing and chemical changes in China (Changsu, humid subtropical climate), while in Italy (Rome, hot-summer Mediterranean climate) it underwent macroscopic cracking and greater losses in gloss. Spectroscopic studies have permitted identification of degradation products and changes in polymer structure over time. Comparisons are made to fielded modules with fluoropolymer-based backsheets, as well as backsheet materials in accelerated laboratory exposures. Implications for qualification testing and service life prediction of the non-fluoropolymer-based backsheets are discussed.

14 SOLAR ENERGY↗
DOE OSTI2018

Constraining Genome-Scale Models to Represent the Bow Tie Structure of Metabolism for 13 C Metabolic Flux Analysis

Determination of internal metabolic fluxes is crucial for fundamental and applied biology because they map how carbon and electrons flow through metabolism to enable cell function. 13 C Metabolic Flux Analysis ( 13 C MFA) and Two-Scale 13 C Metabolic Flux Analysis (2S- 13 C MFA) are two techniques used to determine such fluxes. Both operate on the simplifying approximation that metabolic flux from peripheral metabolism into central “core” carbon metabolism is minimal, and can be omitted when modeling isotopic labeling in core metabolism. The validity of this “two-scale” or “bow tie” approximation is supported both by the ability to accurately model experimental isotopic labeling data, and by experimentally verified metabolic engineering predictions using these methods. However, the boundaries of core metabolism that satisfy this approximation can vary across species, and across cell culture conditions. Here, we present a set of algorithms that (1) systematically calculate flux bounds for any specified “core” of a genome-scale model so as to satisfy the bow tie approximation and (2) automatically identify an updated set of core reactions that can satisfy this approximation more efficiently. First, we leverage linear programming to simultaneously identify the lowest fluxes from peripheral metabolism into core metabolism compatible with the observed growth rate and extracellular metabolite exchange fluxes. Second, we use Simulated Annealing to identify an updated set of core reactions that allow for a minimum of fluxes into core metabolism to satisfy these experimental constraints. Together, these methods accelerate and automate the identification of a biologically reasonable set of core reactions for use with 13 C MFA or 2S- 13 C MFA, as well as provide for a substantially lower set of flux bounds for fluxes into the core as compared with previous methods. We provide an open source Python implementation of these algorithms at https://github.com/JBEI/limitfluxtocore.

13C metabolic flux analysis↗
DOE OSTI2022

Evaluation of an in vitro three-dimensional HepaRG spheroid model for genotoxicity testing using the high-throughput CometChip platform

Three-dimensional (3D) culture systems are increasingly being used for genotoxicity studies due to improved cell-to-cell interactions and tissue-like structures that are limited or lacking in 2D cultures. The present study optimized a 3D culture system using metabolically competent HepaRG cells for in vitro genotoxicity testing. 3D HepaRG spheroids, formed in 96- or 384-well ultra-low attachment plates, were exposed to various concentrations of 34 test articles, including 8 direct-acting and 11 indirect-acting genotoxicants/carcinogens as well as 15 compounds that show different genotoxic responses in vitro and in vivo. DNA damage was evaluated using the high-throughput CometChip assay with concurrent cytotoxicity assessment by the ATP assay in both 2D and 3D cultures. 3D HepaRG spheroids maintained a stable phenotype for up to 30 days with higher levels of albumin secretion, cytochrome P450 gene expression, and enzyme activities compared to 2D cultures. 3D spheroids also demonstrated a higher sensitivity than 2D cultures for detecting both direct- and indirect-acting genotoxicants/carcinogens, indicating a better prediction of in vivo genotoxicity responses. When DNA damage dose-response data were quantified using PROAST software, 3D spheroids generally had lower or similar benchmark dose values compared to 2D HepaRG cells and were more comparable with primary human hepatocytes. These results demonstrate that 3D models can be adapted to the CometChip technology for high-throughput genotoxicity testing and that 3D HepaRG spheroids may be used as a reliable and pragmatic in vitro approach to better support the hazard identification and risk assessment of potential human genotoxic carcinogens.

60 APPLIED LIFE SCIENCES↗