Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “DNA sequencing”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 253 records · Page 14
All sourcesNASA NTRSDOE OSTI
DOE OSTI2021

Global overview and major challenges of host prediction methods for uncultivated phages

Bacterial communities play critical roles across all of Earth’s biomes, affecting human health and global ecosystem functioning. They do so under strong constraints exerted by viruses, i.e., bacteriophages or “phages”. Phages can reshape bacterial communities’ structure, influence long-term evolution of bacterial populations, and alter host cell metabolism during infection. Metagenomics approaches, i.e., shotgun sequencing of environmental DNA or RNA, recently enabled large-scale exploration of phage genomic diversity, yielding several millions of phage genomes now to be further analyzed and characterized. One major challenge however is the lack of direct host information for these phages. Several methods and tools have been proposed to bioinformatically predict the potential host(s) of uncultivated phages based only on genome sequence information. Here we review these different approaches and highlight their distinct strengths and limitations. We also outline complementary experimental assays which are being proposed to validate and refine these bioinformatic predictions.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Structures of ISCth4 transpososomes reveal the role of asymmetry in copy-out/paste-in DNA transposition

Copy-out/paste-in transposition is a major bacterial DNA mobility pathway. It contributes significantly to the emergence of antibiotic resistance, often by upregulating expression of downstream genes upon integration. Unlike other transposition pathways, it requires both asymmetric and symmetric strand transfer steps. Here, we report the first structural study of a copy-out/paste-in transposase and demonstrate its ability to catalyze all pathway steps in vitro. X-ray structures of ISCth4 transposase, a member of the IS256 family of insertion sequences, bound to DNA substrates corresponding to three sequential steps in the reaction reveal an unusual asymmetric dimeric transpososome. During transposition, an array of N-terminal domains binds a single transposon end while the catalytic domain moves to accommodate the varying substrates. These conformational changes control the path of DNA flanking the transposon end and the generation of DNA-binding sites. Our results explain the asymmetric outcome of the initial strand transfer and show how DNA binding is modulated by the asymmetric transposase to allow the capture of a second transposon end and to integrate a circular intermediate.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

A novel conjugative transposon carrying an autonomously amplified plasmid

Tetracyclines serve as broad-spectrum antibiotics to treat bacterial infections. The discovery of new tetracycline resistance genes has led to new questions about the underlying mechanisms of resistance, gene transfer, and their relevance to human health. We tracked changes in the abundance of a 55-kbp conjugative transposon (CTn214) carrying tetQ, a tetracycline resistance gene, within a Bacteroides fragilis metagenome-assembled genome derived from shotgun sequencing of microbial DNA extracted from the ileal pouch of a patient with ulcerative colitis. The mapping of metagenomic reads to CTn214 revealed the multi-copy nature of a 17,044-nt region containing tetQ in samples collected during inflammation and uninflamed visits. B. fragilis cultivars isolated from the same patient during periods of inflammation harbored CTn214 integrated into the chromosome or both a circular, multi-copy, extrachromosomal region of the CTn214 containing tetQ and the corresponding integrated form. The tetracycline-dependent mechanism for the transmission of CTn214 is nearly identical to a common conjugative transposon found in the genome of B. fragilis (CTnDOT), but the autonomously amplified nature of a circular 17,044-nt region of CTn214 that codes for tetQ and the integration of the same sequence in the linear chromosome within the same cell is a novel observation. Genome and transcriptome sequencing of B. fragilis cultivars grown under different concentrations of tetracycline and ciprofloxacin indicates that tetQ in strains containing the circular form remains actively expressed regardless of treatment, while the expression of tetQ in strains containing the linear form increases only in the presence of tetracycline.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

CRISPR-Cas “Non-Target” Sites Inhibit On-Target Cutting Rates

CRISPR-Cas systems have become ubiquitous for genome editing in eukaryotic as well as bacterial systems. Cas9 forms a complex with a guide RNA (gRNA) and searches DNA for a matching sequence (target site) next to a protospacer adjacent motif (PAM). Once found, Cas9 cuts the DNA. Cas9 is revolutionary for the ability to change the RNA sequence and target a new site easily. However, while algorithms have been developed to predict gRNA-specific Cas9 activity, a fundamental biological understanding of gRNA-specific activity is lacking. Here, the number of PAM sites in the genome is effectively a large pool of inhibitory substrates, competing with the target site for the Cas9/gRNA complex. We demonstrate that increasing the number of non-target sites for a given gRNA reduces on-target activity in a dose-dependent manner. Furthermore, we show that the use of Cas9 mutants with increased PAM specificity toward a smaller subset of PAMs (or smaller pool of competitive substrates) improves cutting rates, while increased PAM promiscuity decreases cutting rates. Decreasing the potential search space by increasing PAM specificity provides a path toward improving on-target activity for slower high-fidelity Cas9 variants. Engineering improved PAM specificity to reduce the competitive search space offers an alternative strategy to engineer Cas9 variants with increased specificity and maintained on-target activity.

24 POWER TRANSMISSION AND DISTRIBUTION↗
DOE OSTI2025

Tropical Forest Soil Microbiome Modulates Leaf Heat Tolerance More Strongly Under Warming Than Ambient Conditions

ABSTRACT It is unclear how plants respond to increasing temperatures. Leaf heat tolerance (LHT) is often at its upper limit in tropical forests, suggesting that climate change might negatively impact these forests. We hypothesized that intraspecific variation in LHT might be associated with changes in the soil microbiome, which might also respond to climate. We hypothesized that warming would increase LHT through changes in the soil microbiome: we combined an in situ tropical warming experiment with a shade house experiment in Puerto Rico. The shade house experiment consisted of growing seedlings of Guarea guidonia , a dominant forest species, under different soil microbiome treatments (reduced arbuscular mycorrhizal fungi, reduced plant pathogens, reduced microbes, and unaltered) and soil inoculum from the field experiment. Heat tolerance was determined using chlorophyll fluorescence ( F V /F m ) on individual seedlings in the field and on groups of seedlings (per pot) in the shade house. We sequenced soil fungal DNA to analyze the impacts of the treatments on the soil microbiome. In the field, seedlings from ambient temperature plots showed higher F V /F m values under high temperatures (0.648 at 46°C and 0.067 at 52°C) than seedlings from the warming plots (0.535 at 46°C and 0.031 at 52°C). In the shade house, the soil microbiome treatments significantly influenced the fungal community composition and LHT ( T crit and F V /F m ). Reduction in fungal pathogen abundance and diversity altered F V /F m before T 50 for seedlings grown with soil inoculum from the warming plots but after T 50 for seedlings grown with soil inoculum from the ambient plots. Our findings emphasize that the soil microbiome plays an important role in modulating the impacts of climate change on plants. Understanding and harnessing this relationship might be vital for mitigating the effects of warming on forests, emphasizing the need for further research on microbial responses to climate change.

Hernandes Villani, Gabriela [Department of Plant B↗
DOE OSTI2021

Impacts of The Wetland Sedge Carex aquatilis on Microbial Community and Methane Metabolisms

Microbial activity in the soil of wetlands is responsible for the emission of more methane to the atmosphere than all other natural sources combined. This microbial activity is heavily impacted by plant roots, which influence the microbial community by exuding organic compounds and by leaking oxygen into an otherwise anoxic environment. This study compared the microbial communities of planted and unplanted wetland soil from an Alaskan bog to elucidate how plant growth influences populations and metabolisms of methanogens and methanotrophs. A common boreal wetland sedge, Carex aquatilis, was grown in the laboratory and DNA samples were sequenced from the rhizosphere, unplanted bulk soil, and a simulated rhizosphere with oxygen input but no organic carbon. The abundance of both methanogens and methanotrophs were positively correlated with methane emissions. Among the methanotrophs, both aerobic and anaerobic methane oxidizing microbes were more common in the rhizosphere of mature plants than in unplanted soil, while facultative methanotrophs capable of utilizing either methane or other molecules became relatively less common. Furthermore, these trends indicate that the roots in this experiment created an environment which favored highly specialized microbial metabolisms over generalist approaches. One aspect of this specialized microbiome is the presence of both aerobic and anaerobic metabolisms, which indicates that oxygen is present but is a limiting resource controlling competition.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2022

Low cost and massively parallel force spectroscopy with fluid loading on a chip

Current approaches for single molecule force spectroscopy are typically constrained by low throughput and high instrumentation cost. Herein, a low-cost, high throughput technique is demonstrated using microfluidics for multiplexed mechanical manipulation of up to ~4000 individual molecules via molecular fluid loading on-a-chip (FLO-Chip). The FLO-Chip consists of serially connected microchannels with varying width, allowing for simultaneous testing at multiple loading rates. Molecular force measurements are demonstrated by dissociating Biotin-Streptavidin and Digoxigenin-AntiDigoxigenin interactions along with unzipping of double stranded DNA of varying sequence under different dynamic loading rates and solution conditions. Rupture force results under varying loading rates and solution conditions are in good agreement with prior studies, verifying a versatile approach for single molecule biophysics and molecular mechanobiology. FLO-Chip enables straightforward, rapid, low-cost, and portable mechanical testing of single molecules that can be implemented on a wide range of microscopes to broaden access and may enable new applications of molecular force spectroscopy.

42 ENGINEERING↗
DOE OSTI2025

A multi-omic characterization of the physiological responses to salt stress in Scenedesmus obliquus UTEX393

Scenedesmus obliquus UTEX393 is a promising microalgal candidate for sustainable biomanufacturing but its limited halotolerance hinders large-scale cultivation in saline environments. To investigate the molecular basis of salt stress responses, we conducted a comprehensive multi-omic analysis integrating genomics, transcriptomics, proteomics, lipidomics, metabolomics, and DNA affinity purification sequencing (DAP-seq). An improved nuclear genome assembly and annotation yielded 19,017 gene models and a 97% BUSCO completeness score, enabling construction of a genome-scale metabolic model. Comparing 15 ppt salinity stress to 5 ppt control, growth and productivity were significantly reduced, accompanied by widespread transcriptomic and proteomic changes. Transcriptomic analysis revealed downregulation of photosynthetic machinery and energy conservation genes, and upregulation of stress-responsive elements such as expansins, flavodoxins, and osmoprotectants. Lipidomic profiling showed accumulation of triacylglycerols (TAGs) and degradation of galactosyl lipids, consistent with a shift toward lipid biosynthesis to mitigate redox imbalance. Depletion of key polar metabolites and branched-chain amino acids suggested a rerouting of central carbon metabolism under stress. DAP-seq identified key transcription factors, including LHY1 and SPL12, that target central metabolic enzymes involved in redox balancing, such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and malate dehydrogenase (MDH). These findings establish a regulatory-metabolic framework linking redox stress to lipid accumulation and reveal potential engineering targets to enhance salt tolerance. Overall, the multi-omic analysis supports the “overflow” hypothesis, where impaired photosynthesis results in excess reducing equivalents being diverted into TAG synthesis and highlights transcriptional regulators as candidates for improving algal robustness in brackish environments.

09 BIOMASS FUELS↗
DOE OSTI2020

The regulatory and transcriptional landscape associated with carbon utilization in a filamentous fungus

Filamentous fungi, such as Neurospora crassa , are very efficient in deconstructing plant biomass by the secretion of an arsenal of plant cell wall-degrading enzymes, by remodeling metabolism to accommodate production of secreted enzymes, and by enabling transport and intracellular utilization of plant biomass components. Although a number of enzymes and transcriptional regulators involved in plant biomass utilization have been identified, how filamentous fungi sense and integrate nutritional information encoded in the plant cell wall into a regulatory hierarchy for optimal utilization of complex carbon sources is not understood. Here, we performed transcriptional profiling of N. crassa on 40 different carbon sources, including plant biomass, to provide data on how fungi sense simple to complex carbohydrates. From these data, we identified regulatory factors in N. crassa and characterized one (PDR-2) associated with pectin utilization and one with pectin/hemicellulose utilization (ARA-1). Using in vitro DNA affinity purification sequencing (DAP-seq), we identified direct targets of transcription factors involved in regulating genes encoding plant cell wall-degrading enzymes. In particular, our data clarified the role of the transcription factor VIB-1 in the regulation of genes encoding plant cell wall-degrading enzymes and nutrient scavenging and revealed a major role of the carbon catabolite repressor CRE-1 in regulating the expression of major facilitator transporter genes. These data contribute to a more complete understanding of cross talk between transcription factors and their target genes, which are involved in regulating nutrient sensing and plant biomass utilization on a global level.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Populus MYC2 orchestrates root transcriptional reprogramming of defence pathway to impair Laccaria bicolor ectomycorrhizal development

Summary The jasmonic acid (JA) signalling pathway plays an important role in the establishment of the ectomycorrhizal symbiosis. The Laccaria bicolor effector MiSSP7 stabilizes JA corepressor JAZ6, thereby inhibiting the activity of Populus MYC2 transcription factors. Although the role of MYC2 in orchestrating plant defences against pathogens is well established, its exact contribution to ECM symbiosis remains unclear. This information is crucial for understanding the balance between plant immunity and symbiotic relationships. Transgenic poplars overexpressing or silencing for the two paralogues of MYC2 transcription factor (MYC2s) were produced, and their ability to establish ectomycorrhiza was assessed. Transcriptomics and DNA affinity purification sequencing were performed. MYC2s overexpression led to a decrease in fungal colonization, whereas its silencing increased it. The enrichment of terpene synthase genes in the MYC2‐regulated gene set suggests a complex interplay between the host monoterpenes and fungal growth. Several root monoterpenes have been identified as inhibitors of fungal growth and ECM symbiosis. Our results highlight the significance of poplar MYC2s and terpenes in mutualistic symbiosis by controlling root fungal colonization. We identified poplar genes which direct or indirect control by MYC2 is required for ECM establishment. These findings deepen our understanding of the molecular mechanisms underlying ECM symbiosis.

Marqués‐Gálvez, José Eduardo↗
DOE OSTI2025

Old Woman Creek Wetland Sediment and Electrochemical Sensor Microbial Community, 2023

We are developing a technique to monitor microbiological activities referred to as zero resistance ammetry, which entails the deployment of graphite electrodes in sediments. Measurement of current between electrodes of contrasting redox regimes and/or predominant terminal electron accepting processes can be used as an indicator of the extents of microbiological activity. We deployed an electrode array at depths of 2 mm, 4 mm, 76 mm, 78 mm, 152 mm, 154 mm, 227 mm, and 229 mm below the wetland sediment water interface in the Old Woman Creek National Estuarine Research Center, Huron, OH, USA (Lat. = 41.380833, Long. = -82.508889). A core was collected from adjacent sediment and subsamples were collected from depth intervals of 0 – 25 mm, 25 – 127 mm, 127 – 128 mm, and below 178 mm. To determine if the microbial communities attached to the electrodes were reflective of the adjacent sediment-associated microbial community, we conducted a 16S rRNA gene-based (V4 region) survey of these respective materials. This data package contains the results of these surveys, including metadata on the depths from which samples were collected (samples.csv), DNA extraction and sequencing information (OWC_DEPTH_AMPLICON_SEQUENCING_METADATA), sequence processing information (OWC_DEPTH_BIOINFORMATIC_METADATA.csv), an operational taxonomic unit (OTU) table (OWC_DEPTH_97OTUS_TABLE.csv), and nucleotide sequences of OTUs (OWC_DEPTH_97OTUS_SEQS.fasta). All files can be opened using a text-editing application. The fasta file is compatible with bioinformatics applications.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2020

Predicting Drug Resistance Using Deep Mutational Scanning

Drug resistance is a major healthcare challenge, resulting in a continuous need to develop new inhibitors. The development of these inhibitors requires an understanding of the mechanisms of resistance for a critical mass of occurrences. Recent genome editing technologies based on high-throughput DNA synthesis and sequencing may help to predict mutations resulting in resistance by testing large mutagenesis libraries. Here we describe the rationale of this approach, with examples and relevance to drug development and resistance in malaria.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Double DAP-seq uncovered synergistic DNA binding of interacting bZIP transcription factors

Many eukaryotic transcription factors (TF) form homodimer or heterodimer complexes to regulate gene expression. Dimerization of BASIC LEUCINE ZIPPER (bZIP) TFs are critical for their functions, but the molecular mechanism underlying the DNA binding and functional specificity of homo- versus heterodimers remains elusive. To address this gap, we present the double DNA Affinity Purification-sequencing (dDAP-seq) technique that maps heterodimer binding sites on endogenous genomic DNA. Using dDAP-seq we profile twenty pairs of C/S1 bZIP heterodimers and S1 homodimers in Arabidopsis and show that heterodimerization significantly expands the DNA binding preferences of these TFs. Analysis of dDAP-seq binding sites reveals the function of bZIP9 in abscisic acid response and the role of bZIP53 heterodimer-specific binding in seed maturation. The C/S1 heterodimers show distinct preferences for the ACGT elements recognized by plant bZIPs and motifs resembling the yeast GCN4 cis -elements. This study demonstrates the potential of dDAP-seq in deciphering the DNA binding specificities of interacting TFs that are key for combinatorial gene regulation.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Conformational Changes of RORγ During Response Element Recognition and Coregulator Engagement

The retinoic acid receptor-related orphan receptor γ (RORγ) is a ligand-dependent transcription factor of the nuclear receptor super family that underpins metabolic activity, immune function, and cancer progression. Despite being a valuable drug target in health and disease, our understanding of the ligand-dependent activities of RORγ is far from complete. Like most nuclear receptors, RORγ must recruit coregulatory protein to enact the RORγ target gene program. To date, a majority of structural studies have been focused exclusively on the RORγ ligand-binding domain and the ligand-dependent recruitment of small peptide segments of coregulators. Herein, we examine the ligand-dependent assembly of full length RORγ:coregulator complexes on cognate DNA response elements using structural proteomics and small angle x-ray scattering. The results from our studies suggest that RORγ becomes elongated upon DNA recognition, preventing long range interdomain crosstalk. We also determined that the DNA binding domain adopts a sequence-specific conformation, and that coregulatory protein may be able to ‘sense’ the ligand- and DNA-bound status of RORγ. We propose a model where ligand-dependent coregulator recruitment may be influenced by the sequence of the DNA to which RORγ is bound. Overall, the efforts described herein will illuminate important aspects of full length RORγ and monomeric orphan nuclear receptor target gene regulation through DNA-dependent conformational changes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Allosteric autoregulation of DNA binding via a DNA-mimicking protein domain: a biophysical study of ZNF410–DNA interaction using small angle X-ray scattering

ZNF410 is a highly-conserved transcription factor, remarkable in that it recognizes a 15-base pair DNA element but has just a single responsive target gene in mammalian erythroid cells. ZNF410 includes a tandem array of five zinc-fingers (ZFs), surrounded by uncharacterized N- and C-terminal regions. Unexpectedly, full-length ZNF410 has reduced DNA binding affinity, compared to that of the isolated DNA binding ZF array, both in vitro and in cells. AlphaFold predicts a partially-folded N-terminal subdomain that includes a 30-residue long helix, preceded by a hairpin loop rich in acidic (aspartate/glutamate) and serine/threonine residues. This hairpin loop is predicted by AlphaFold to lie against the DNA binding interface of the ZF array. In solution, ZNF410 is a monomer and binds to DNA with 1:1 stoichiometry. Surprisingly, the single best-fit model for the experimental small angle X-ray scattering profile, in the absence of DNA, is the original AlphaFold model with the N-terminal long-helix and the hairpin loop occupying the ZF DNA binding surface. For DNA binding, the hairpin loop presumably must be displaced. After combining biophysical, biochemical, bioinformatic and artificial intelligence-based AlphaFold analyses, we suggest that the hairpin loop mimics the structure and electrostatics of DNA, and provides an additional mechanism, supplementary to sequence specificity, of regulating ZNF410 DNA binding.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗