Engineering Papers⌕ Search

SEARCH · Engineering Papers

Results for “DNA, Plant”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 199 records · Page 11
All sourcesNASA NTRSDOE OSTI
DOE OSTI2022

A polypeptide model for toxic aberrant proteins induced by aminoglycoside antibiotics

Aminoglycoside antibiotics interfere with the selection of cognate tRNAs during translation, resulting in the synthesis of aberrant proteins that are the ultimate cause of cell death. However, the toxic potential of aberrant proteins and how they avoid degradation by the cell’s protein quality control (QC) machinery are not understood. Here we report that levels of the heat shock (HS) transcription factor σ32 increased sharply following exposure of Escherichia coli to the aminoglycoside kanamycin (Kan), suggesting that at least some of the aberrant proteins synthesized in these cells were recognized as substrates by DnaK, a molecular chaperone that regulates the HS response, the major protein QC pathway in bacteria. To further investigate aberrant protein toxic potential and interaction with cell QC factors, we studied an acutely toxic 48-residue polypeptide (ARF48) that is encoded by an alternate reading frame in a plant cDNA. As occurred in cells exposed to Kan, σ32 levels were strongly elevated following ARF48 expression, suggesting that ARF48 was recognized as a substrate by DnaK. Paradoxically, an internal 10-residue region that was tightly bound by DnaK in vitro also was required for the ARF48 toxic effect. Despite the increased levels of σ32, levels of several HS proteins were unchanged following ARF48 expression, suggesting that the HS response had been aborted. Nucleoids were condensed and cell permeability increased rapidly following ARF48 expression, together suggesting that ARF48 disrupts DNA-membrane interactions that could be required for efficient gene expression. Our results are consistent with earlier studies showing that aberrant proteins induced by aminoglycoside antibiotics disrupt cell membrane integrity. Insights into the mechanism for this effect could be gained by further study of the ARF48 model system.

36 MATERIALS SCIENCE↗
DOE OSTI2020

Prevalent root-derived phenolics drive shifts in microbial community composition and prime decomposition in forest soil

Phenolic compounds perform various functions in soil ranging from microbial substrate to toxin and form the basis of several plant-mediated processes. The aim of this study was to investigate how phenolics commonly exuded by tree roots influence soil organic matter (SOM) decomposition and interact with other labile forms of carbon (C) abundant in root exudates. Therefore, we performed a 38-day incubation experiment and assessed whether phenolic compounds (benzoic acid, caffeic acid and catechin) facilitated or inhibited SOM decomposition in a glucose-amended forest soil. Changes in decomposition, substrate use, fungal and bacterial community composition, and microbial abundance and activity were measured over time using 13 C-stable-isotope tracing, DNA-based molecular methods and enzyme assays. Our findings showed that phenolics inhibited microbial activity and abundance to varying degrees. Yet, benzoic acid was the only compound producing a substantial priming effect leading to a 21% increase in SOM decomposition, which was amplified in glucose-amended soils. This stimulation in microbial activity was associated with an increase in β-1,4-glucosidase activity and the bacterial genera Paraburkholderia and Caballeronia of the Burkholderiaceae family. Phenolics drove microbial community shifts in glucose-amended soils with negligible interactive effects. In conclusion, phenolic priming of SOM decomposition is associated with microbial community shifts and amplified in the presence of glucose. This evidence emphasizes the need for considering phenolics and interactions among root exudates as priming mechanisms in the rhizosphere and other soil environments where aromatics and phenolic compounds are abundant.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

DISCo-microbe: design of an identifiable synthetic community of microbes

Microbiomes are extremely important for their host organisms, providing many vital functions and extending their hosts’ phenotypes. Natural studies of host-associated microbiomes can be difficult to interpret due to the high complexity of microbial communities, which hinders our ability to track and identify individual members along with the many factors that structure or perturb those communities. For this reason, researchers have turned to synthetic or constructed communities in which the identities of all members are known. However, due to the lack of tracking methods and the difficulty of creating a more diverse and identifiable community that can be distinguished through next-generation sequencing, most such in vivo studies have used only a few strains. To address this issue, we developed DISCo-microbe, a program for the design of an identifiable synthetic community of microbes for use in in vivo experimentation. The program is composed of two modules; (1) create, which allows the user to generate a highly diverse community list from an input DNA sequence alignment using a custom nucleotide distance algorithm, and (2) subsample, which subsamples the community list to either represent a number of grouping variables, including taxonomic proportions, or to reach a user-specified maximum number of community members. As an example, we demonstrate the generation of a synthetic microbial community that can be distinguished through amplicon sequencing. The synthetic microbial community in this example consisted of 2,122 members from a starting DNA sequence alignment of 10,000 16S rRNA sequences from the Ribosomal Database Project. We generated simulated Illumina sequencing data from the constructed community and demonstrate that DISCo-microbe is capable of designing diverse communities with members distinguishable by amplicon sequencing. Using the simulated data we were able to recover sequences from between 97–100% of community members using two different post-processing workflows. Furthermore, 97–99% of sequences were assigned to a community member with zero sequences being misidentified. We then subsampled the community list using taxonomic proportions to mimic a natural plant host–associated microbiome, ultimately yielding a diverse community of 784 members. DISCo-microbe can create a highly diverse community list of microbes that can be distinguished through 16S rRNA gene sequencing, and has the ability to subsample (i.e., design) the community for the desired number of members and taxonomic proportions. Although developed for bacteria, the program allows for any alignment input from any taxonomic group, making it broadly applicable. The software and data are freely available from GitHub and Python Package Index (PYPI).

16S rRNA↗
DOE OSTI2022

Delimiting the cryptic diversity and host preferences of Sycophila parasitoid wasps associated with oak galls using phylogenomic data

Abstract Cryptic species diversity is a major challenge regarding the species‐rich community of parasitoids attacking oak gall wasps due to a high degree of sexual dimorphism, morphological plasticity, small size and poorly known biology. As such, we know very little about the number of species present, nor the evolutionary forces responsible for generating this diversity. One hypothesis is that trait diversity in the gall wasps, including the morphology of the galls they induce, has evolved in response to selection imposed by the parasitoid community, with reciprocal selection driving diversification of the parasitoids. Using a rare, continental‐scale data set of Sycophila parasitoid wasps reared from 44 species of cynipid galls from 18 species of oak across the USA, we combined mitochondrial DNA barcodes, ultraconserved elements (UCEs), morphological and natural history data to delimit putative species. Using these results, we generate the first large‐scale assessment of ecological specialization and host association in this species‐rich group, with implications for evolutionary ecology and biocontrol. We find most Sycophila target specific subsets of available cynipid host galls with similar morphologies, and generally attack larger galls. Our results suggest that parasitoid wasps such as Sycophila have adaptations allowing them to exploit particular host trait combinations, while hosts with contrasting traits are resistant to attack. These findings support the tritrophic niche concept for the structuring of plant–herbivore–parasitoid communities.

Zhang, Yuanmeng M.↗
DOE OSTI2021

In vitro effects of cannabidiol and its main metabolites in mouse and human Sertoli cells

Cannabidiol (CBD) is a major cannabinoid present in extracts of the plant Cannabis sativa (marijuana). While the therapeutic effects of CBD on epilepsy have been demonstrated, less is understood regarding its potential adverse effects. Recent studies revealed that CBD induced toxicity in the male reproductive system of animal models. In this study, we used TM4, an immortalized mouse Sertoli cell line, and primary human Sertoli cells to evaluate the toxicities of CBD and its main metabolites, 7-carboxy-CBD and 7-hydroxy-CBD. CBD induced concentration- and time-dependent cytotoxicity in mouse and human Sertoli cells, which mainly resulted from the inhibition of the G1/S-phase cell cycle transition. CBD also inhibited DNA synthesis and downregulated key cell cycle proteins. Moreover, CBD reduced the mRNA and protein levels of a functional marker, Wilms’ tumor 1. Similar to CBD, 7-carboxy-CBD and 7-hydroxy-CBD inhibited cellular proliferation and decreased DNA synthesis. 7-Carboxy-CBD was less cytotoxic than CBD, while 7-hydroxy-CBD showed comparable cytotoxicity to CBD in both mouse and human Sertoli cells. Compared to mouse Sertoli cells, CBD, 7-hydroxy-CBD, and 7-carboxy-CBD were more cytotoxic in human Sertoli cells. Finally, our results indicate that CBD and its main metabolites can inhibit cell proliferation in mouse and human Sertoli cells.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Niche Partitioning of Microbial Communities at an Ancient Vitrified Hillfort: Implications for Vitrified Radioactive Waste Disposal

A pre-Viking era vitrified hillfort, Broborg, provides a habitat analogue for disposed radioactive waste glass and shows strong niche partitioning among the organisms involved in glass alteration. Microbes cannot be eliminated from radioactive waste disposal facilities and the consequences of bio-colonization must be understood. We use Broborg as a model system to inform what microbial processes might influence long-term radioactive waste glass durability by examining anthropogenic glass that has been subjected to bio-colonization for over 1,500 years. Scanning electron microscopy (SEM) images reveal the surficial biofilm structure, and chemical/mineralogy analysis in combination with deoxyribonucleic acid (DNA) sequencing of samples from the vitrified substrate, the adjacent soil, and the general topsoil provide insight into niche partitioning. The ancient glass niche supports a unique microbial community of bacteria, fungi, and protists that manifests the species response to local geochemical and mineralogical conditions. Communities from the geochemical niche associated with the glass are distinct and less diverse than soil communities. The microbiome of the glass and adjacent soil are dominated by lichens, lichen-associated microorganisms, and other epilithic, endolithic, and epigeic organisms. Pseudomonads dominate the prokaryotic communities on the vitrified material, but not the adjacent soil. In contrast, the general topsoil communities are enriched in plant rhizosphere organisms. Taxa associated with vitrification have bio-corrosive properties that could be detrimental to glass durability, including silicate mineral dissolution, extraction of essential elements, secretion of geochemically reactive organic acids, and dissolution induced by improved water retention. However, these stable long-term biofilms also possess a homeostatic function that could limit glass alteration. Overall, this study demonstrates the potential impacts that microbial colonization and niche partitioning can have on glass alteration and subsequent release of radionuclides from a disposal facility for vitrified radioactive waste.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Discovery of photosynthesis genes through whole-genome sequencing of acetate-requiring mutants of Chlamydomonas reinhardtii

Large-scale mutant libraries have been indispensable for genetic studies, and the development of next-generation genome sequencing technologies has greatly advanced efforts to analyze mutants. In this work, we sequenced the genomes of 660 Chlamydomonas reinhardtii acetate-requiring mutants, part of a larger photosynthesis mutant collection previously generated by insertional mutagenesis with a linearized plasmid. We identified 554 insertion events from 509 mutants by mapping the plasmid insertion sites through paired-end sequences, in which one end aligned to the plasmid and the other to a chromosomal location. Nearly all (96%) of the events were associated with deletions, duplications, or more complex rearrangements of genomic DNA at the sites of plasmid insertion, and together with deletions that were unassociated with a plasmid insertion, 1470 genes were identified to be affected. Functional annotations of these genes were enriched in those related to photosynthesis, signaling, and tetrapyrrole synthesis as would be expected from a library enriched for photosynthesis mutants. Systematic manual analysis of the disrupted genes for each mutant generated a list of 253 higher-confidence candidate photosynthesis genes, and we experimentally validated two genes that are essential for photoautotrophic growth, CrLPA3 and CrPSBP4 . The inventory of candidate genes includes 53 genes from a phylogenomically defined set of conserved genes in green algae and plants. Altogether, 70 candidate genes encode proteins with previously characterized functions in photosynthesis in Chlamydomonas , land plants, and/or cyanobacteria; 14 genes encode proteins previously shown to have functions unrelated to photosynthesis. Among the remaining 169 uncharacterized genes, 38 genes encode proteins without any functional annotation, signifying that our results connect a function related to photosynthesis to these previously unknown proteins. This mutant library, with genome sequences that reveal the molecular extent of the chromosomal lesions and resulting higher-confidence candidate genes, will aid in advancing gene discovery and protein functional analysis in photosynthesis.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Evolutionary innovations through gain and loss of genes in the ectomycorrhizal Boletales

Summary We aimed to identify genomic traits of transitions to ectomycorrhizal ecology within the Boletales by comparing the genomes of 21 symbiotrophic species with their saprotrophic brown‐rot relatives. Gene duplication rate is constant along the backbone of Boletales phylogeny with large loss events in several lineages, while gene family expansion sharply increased in the late Miocene, mostly in the Boletaceae. Ectomycorrhizal Boletales have a reduced set of plant cell‐wall‐degrading enzymes (PCWDEs) compared with their brown‐rot relatives. However, the various lineages retain distinct sets of PCWDEs, suggesting that, over their evolutionary history, symbiotic Boletales have become functionally diverse. A smaller PCWDE repertoire was found in Sclerodermatineae. The gene repertoire of several lignocellulose oxidoreductases (e.g. laccases) is similar in brown‐rot and ectomycorrhizal species, suggesting that symbiotic Boletales are capable of mild lignocellulose decomposition. Transposable element (TE) proliferation contributed to the higher evolutionary rate of genes encoding effector‐like small secreted proteins, proteases, and lipases. On the other hand, we showed that the loss of secreted CAZymes was not related to TE activity but to DNA decay. This study provides novel insights on our understanding of the mechanisms influencing the evolutionary diversification of symbiotic boletes.

Wu, Gang↗
DOE OSTI2025

A novel regulator of the fungal phosphate starvation response revealed by transcriptional profiling and DNA affinity purification sequencing

Cells must accurately sense and respond to nutrients to compete for resources and establish growth. Phosphate is a critical nutrient source necessary for signaling, energy metabolism, and synthesis of nucleic acids, phospholipids, and cellular metabolites. During phosphate limitation, fungi import phosphate from the environment and liberate phosphate from phosphate-containing molecules in the cell. In the model filamentous fungus Neurospora crassa, the phosphate starvation response is regulated by the conserved transcription factor NUC-1. The activity of NUC-1 is repressed by a complex of the cyclin-dependent kinase MDK-1 and the cyclin PREG when phosphate is plentiful. When phosphate is limiting, NUC-1 repression by MDK-1/PREG is relieved by the cyclin-dependent kinase inhibitor NUC-2. We investigated the global response of N. crassa to phosphate starvation. During phosphate starvation, NUC-1 directly activated the expression of genes encoding phosphatases, nucleases, and a phosphate transporter and directly repressed genes associated with the ribosome. Additionally, NUC-1 indirectly activated the expression of an uncharacterized transcription factor, which we named nuc-3. NUC-3 directly repressed the expression of genes involved in phosphate acquisition and liberation after an extended period of phosphate starvation. Additionally, NUC-3 directly repressed the expression of the cyclin-dependent kinase inhibitor nuc-2. Thus, through the combination of NUC-3 direct repression of genes in the phosphate starvation response and nuc-2, an activator of the phosphate starvation response, NUC-3 serves to act as a brake on the phosphate starvation response after an extended period of phosphate starvation. This braking mechanism could reduce transcription, a phosphate-intensive process, under conditions of extended phosphate limitation.IMPORTANCEFungi have evolved regulatory networks to respond to available nutrients. Phosphate is often a limiting nutrient for fungi that is critical for many cellular functions, including nucleic acid and phospholipid biosynthesis, cell signaling, and energy metabolism. The fungal response to phosphate limitation is important in interactions with plants and animals. We investigated the global transcriptional response to phosphate starvation and the role of a major transcriptional regulator, NUC-1, in the model filamentous fungus Neurospora crassa. Our data show that NUC-1 is a bifunctional transcription factor that directly activates phosphate acquisition genes, while directly repressing genes associated with phosphate-intensive processes. NUC-1 indirectly regulates an uncharacterized transcription factor, which we named nuc-3. NUC-3 directly represses phosphate acquisition genes and nuc-2, an activator of the phosphate starvation response, during extended periods of phosphate starvation. Thus, NUC-3 acts as a brake on the phosphate starvation response to reduce phosphate-intensive activities, like transcriptional activation, when phosphate starvation persists.

DNA affinity purification sequencing↗
DOE OSTI2025

Community‐Level Metabolic Shifts Following Land Use Change in the Amazon Rainforest Identified by a Supervised Machine Leaning Approach

ABSTRACT The Amazon rainforest has been subjected to high rates of deforestation, mostly for pasturelands, over the last few decades. This change in plant cover is known to alter the soil microbiome and the functions it mediates, but the genomic changes underlying this response are still unresolved. In this study, we used a combination of deep shotgun metagenomics complemented by a supervised machine learning approach to compare the metabolic strategies of tropical soil microbial communities in pristine forests and long‐term established pastures in the Amazon. Machine learning‐derived metagenome analysis indicated that microbial community structures (bacteria, archaea and viruses) and the composition of protein‐coding genes were distinct in each plant cover type environment. Forest and pasture soils had different genomic diversities for the above three taxonomic groups, characterised by their protein‐coding genes. These differences in metagenome profiles in soils under forests and pastures suggest that metabolic strategies related to carbohydrate and energy metabolisms were altered at community level. Changes were also consistent with known modifications to the C and N cycles caused by long‐term shifts in aboveground vegetation and were also associated with several soil physicochemical properties known to change with land use, such as the C/N ratio, soil temperature and exchangeable acidity. In addition, our analysis reveals that these alterations in land use can also result in changes to the composition and diversity of the soil DNA virome. Collectively, our study indicates that soil microbial communities shift their overall metabolic strategies, driven by genomic alterations observed in pristine forests and long‐term established pastures with implications for the C and N cycles.

carbon and nitrogen cycles↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Chapter 6: An Improved Leaf Protoplast System for Highly Efficient Transient Expression in Switchgrass (Panicum virgatum L.)

As a robust perennial C4-type monocot plant and a native species to North America, switchgrass (Panicum virgatum) has been evaluated and designated as a strong candidate bioenergy crop by the U.S. DOE. Although genetic modifications of switchgrass have been used to successfully reduce the recalcitrance of switchgrass biomass for biofuel production, the generation of transgenic switchgrass is still a slow and laborious process. A transient protoplast system can provide an excellent platform to accelerate the selection of genes-of-interest for tailoring switchgrass biomass. However, partially due to the lack of the complete genomic information, the attempts to optimize the transient protoplast system for switchgrass remain scarce. In this chapter, we provide an improved protocol for switchgrass protoplast isolation, increased transformation efficiency using CsCl gradient ultracentrifugation-derived plasmid DNA and extended application of the transient switchgrass protoplast system to analyze protein expression using western blot.

BASIC BIOLOGICAL SCIENCES,BIOMASS FUELS↗
DOE OSTI2022

Host genotype controls ecological change in the leaf fungal microbiome

Leaf fungal microbiomes can be fundamental drivers of host plant success, as they contain pathogens that devastate crop plants and taxa that enhance nutrient uptake, discourage herbivory, and antagonize pathogens. We measured leaf fungal diversity with amplicon sequencing across an entire growing season in a diversity panel of switchgrass ( Panicum virgatum ). We also sampled a replicated subset of genotypes across 3 additional sites to compare the importance of time, space, ecology, and genetics. We found a strong successional pattern in the microbiome shaped both by host genetics and environmental factors. Further, we used genome-wide association (GWA) mapping and RNA sequencing to show that 3 cysteine-rich receptor-like kinases (crRLKs) were linked to a genetic locus associated with microbiome structure. We confirmed GWAS results in an independent set of genotypes for both the internal transcribed spacer (ITS) and large subunit (LSU) ribosomal DNA markers. Fungal pathogens were central to microbial covariance networks, and genotypes susceptible to pathogens differed in their expression of the 3 crRLKs, suggesting that host immune genes are a principal means of controlling the entire leaf microbiome.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Thermophilic site-specific recombination system for rapid insertion of heterologous DNA into the Clostridium thermocellum chromosome

Clostridium thermocellum is an anaerobic thermophile capable of producing ethanol and other commodity chemicals from lignocellulosic biomass. The insertion of heterologous DNA into the C. thermocellum chromosome is currently achieved via a time-consuming homologous recombination process, where a single stable insertion can take 2–4 weeks or more to construct. In this work, we developed a thermostable version of the Serine recombinase Assisted Genome Engineering (tSAGE) approach for gene insertion in C. thermocellum utilizing a site-specific recombinase from Geobacillus sp. Y412MC61, enabling quick and easy insertion of DNA into the chromosome for accelerated genetic tool screening and heterologous gene expression. Using tSAGE, chromosomal insertion of plasmid DNA occurred at a maximum transformation efficiency of 5 × 10 3 CFU/µg, which is comparable to the transformation efficiency of a replicating control plasmid in C. thermocellum. Using tSAGE, we chromosomally integrated and characterized 17 reporter genes, 15 homologous and 31 heterologous constitutive promoters of varying strengths, 4 inducible promoters, and 5 riboswitches in C. thermocellum. We also determined that a 6–7 nucleotide gap between the ribosome binding site (RBS) and the start codon is optimal for high expression by employing a library of superfolder green fluorescent protein expression constructs driven by our strongest tested promoter (P clo1313_1194 ) with different distances between the RBS and start codon. The tools developed here will aid in accelerating C. thermocellum strain engineering for producing sustainable fuels and chemicals directly from plant biomass.

Biofuels↗
DOE OSTI2020

Prediction of condition-specific regulatory genes using machine learning

Recent advances in genomic technologies have generated data on large-scale protein–DNA interactions and open chromatin regions for many eukaryotic species. How to identify condition-specific functions of transcription factors using these data has become a major challenge in genomic research. To solve this problem, we have developed a method called ConSReg, which provides a novel approach to integrate regulatory genomic data into predictive machine learning models of key regulatory genes. Using Arabidopsis as a model system, we tested our approach to identify regulatory genes in data sets from single cell gene expression and from abiotic stress treatments. Our results showed that ConSReg accurately predicted transcription factors that regulate differentially expressed genes with an average auROC of 0.84, which is 23.5–25% better than enrichment-based approaches. To further validate the performance of ConSReg, we analyzed an independent data set related to plant nitrogen responses. ConSReg provided better rankings of the correct transcription factors in 61.7% of cases, which is three times better than other plant tools. We applied ConSReg to Arabidopsis single cell RNA-seq data, successfully identifying candidate regulatory genes that control cell wall formation. Our methods provide a new approach to define candidate regulatory genes using integrated genomic data in plants.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2025

Supplementary table, figures and DNA sequences of sorghum gene models SbiRTx430.01G455400 and SbiRTx.02G006600 that feature primers, gRNAs and indels created

In-context promoter bashing via genome editing is a route to identify and characterize critical regulatory regions that govern expression of genes of interest. The outcomes of in-context promoter bashing can be used to inform editing strategies to modulate the expression of selected gene models in a desired fashion. Here we employed in-context promoter bashing to characterize the proximal upstream regulatory regions of sorghum genes encoding phosphoenolpyruvate carboxykinase (Sb.PEPCK.BS, SbiTx430.01G455400) and alanine aminotransferase (SbiTx430.02G006600, SbAlaAT.BS), two proteins involved in the PCK C4 pathway. Characterized germinal edits within the targeted regions upstream of these two genes ranged in size from 138 bp up to 1790 bp. A 138 bp within the Sb.PEPCK.BS upstream region and a 1643 bp element within the Sb.AlaAT.BS upstream region were determined to be important for maintenance of transcription levels. No change in development or various physiological parameters was observed in characterized lineages carrying promoter edits. However, significant changes in seed reserves and a reduction in 100 seed weight were consistently observed, under both greenhouse and field environments, in plants carrying an edit in the promoter of Sb.PEPCK.BS gene were significantly reduced in transcript accumulation for this gene.

Quach, Truyen [Center for Plant Science Innovation↗
DOE OSTI2026

From photosynthetic electron flow to gene regulation: redox signal transduction in cyanobacteria

In cyanobacteria, the free-living ancestors of chloroplasts, photosynthesis simultaneously sustains growth and generates reactive oxygen species (ROS) that damage proteins, lipids, and DNA when light capture outpaces carbon fixation. Maintaining redox balance, therefore, requires cells to read photosynthetic electron flow as a signal that continuously tunes gene expression and protein activity. This review traces how these redox signals are transduced to transcription machinery through three routes: membrane-localized sensors, cytoplasmic redox sensors downstream of photosystem I, and ROS generated when electron sinks are saturated. Membrane-bound histidine kinases (two-component systems) relay the redox state of the plastoquinone pool to control photosystem remodeling, pigment biosynthesis, and circadian timing. Cytoplasmic one-component regulators, by contrast, sense redox directly through thiol-disulfide switches, glutathionylation, iron-sulfur clusters, and metal-catalyzed oxidation to control photosystem-cofactor, electron-carrier, and transition-metal homeostasis. Because many of these regulators persist in algal and plant chloroplasts, cyanobacteria illuminate principles of redox control across photosynthetic eukaryotes. Post-transcriptional and translational control further shapes redox-dependent gene expression programs through transcript stability, ribosome assembly, and translation initiation, extending redox regulation beyond transcription to every step of protein synthesis and even activity modulation. Finally, we connect redox regulation to photosynthetic physiology, stress resilience, and the rational engineering of cyanobacteria for sustainable bioproduction.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Five key aspects of metaproteomics as a tool to understand functional interactions in host-associated microbiomes

Host-associated microbial communities (microbiomes) play critical roles in human, animal, and plant health and development. However, interactions between the host, members of the microbiome, and invading pathogens are in most cases still poorly understood. Such interactions are multidimensional and can alter the taxonomic composition and/or the functional metabolic activities of the microbiome in response to disease or treatment conditions. For example, after 2 days of antibiotic treatment, the mouse gut microbiome is altered and more susceptible to invasion by the pathogen Clostridioides difficile. Studies of these multidimensional interactions have been fueled by the ability to use high-throughput sequencing of phylogenetic marker genes to profile microbial community composition and shotgun metagenomics to profile functional potential. However, many protein-coding genes predicted from metagenomes are not necessarily expressed under a given condition, and thus, it is difficult to assess the activities and functional interactions in microbial communities based on DNA sequencing data alone. The physiological and pathological processes expressed in these communities under specific conditions are better reflected by the abundances of transcripts or proteins. In this Pearl, we provide a brief introduction to metaproteomics, which is a tool for the large-scale analysis of proteins in microbiomes that allows researchers to address a diversity of questions related to functions and interactions in microbiomes. The term “metaproteomics” was first used in 2004 for “the large-scale characterization of the entire protein complement of environmental microbiota at a given point in time”, and since then, a large array of metaproteomics approaches have been developed. Our objective in this Pearl is to highlight what we feel are 5 essential elements to be considered for a metaproteomics research campaign and to introduce nonexpert readers to the topic without going into too much technical detail.

59 BASIC BIOLOGICAL SCIENCES↗