Engineering Papers⌕ Search

Engineering topics

Ahkami, Amir H.

Publications and source records attributed to Ahkami, Amir H..

8 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2024

Salinity-Induced Photorespiration in Populus Vascular Tissues Facilitate Nitrogen Reallocation

Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. Here, we used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell-specific changes in proteins and metabolites were determined. Salinity induced a vascular-specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3-phosphoglycerate and NH 4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH 4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt-induced photorespiration in vascular cells mediates N-reallocation in Populus, an essential process for the adaptation of trees to adverse conditions.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

RhizoMAP: a comprehensive, nondestructive, and sensitive platform for metabolic imaging of the rhizosphere

Elucidating the intricate structural organization and spatial gradients of biomolecular composition within the rhizosphere is critical to understanding important biogeochemical processes, which include the mechanisms of root-microbe interactions for maintaining sustainable plant ecosystem services. While various analytical methods have been developed to assess the spatial heterogeneity within the rhizosphere, a comprehensive view of the fine distribution of metabolites within the root-soil interface has remained a significant challenge. This is primarily due to the difficulty of maintaining the original spatial organization during sample preparation without compromising its molecular content.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Editorial: Cellular heterogeneity in plants

Multicellular eukaryotic organisms, such as plants, consist of various cell types. Despite possessing the same genetic information, each cell exhibits distinct utilization of this information, resulting in the development of unique molecular, physiological, and morphological properties as well as cellular heterogeneity within the organism. This cellular heterogeneity is needed to support plant development and adaptation to environmental changes. Identifying the mechanisms responsible for the differentiation of distinct cell types and precisely characterizing the molecular, biochemical, biophysical, and morphological characteristics of each cell type in various plant species remains a significant objective for plant scientists. Despite the biological importance of these cellular attributes, they have not been adequately described. In this Frontiers Research Topic, “Cellular Heterogeneity in Plants,” various scientific papers provide valuable new insights into the causes and consequences of cellular heterogeneity in plants.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Spatiotemporal metabolic responses to water deficit stress in distinct leaf cell-types of poplar

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue ‘omics’-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar ( Populus tremula× P. alba ) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach (Final Report)

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach In the SyPro Poplar project, we aimed to integrate omics, bioinformatics, synthetic biology, and genetic engineering approaches to develop transgenic poplar trees with sustained photosynthetic activity and increased biomass production under individual and the simultaneous occurrence of water deficit, increased soil salinity, and elevated temperatures. Specifically, we intended to (i) study the functions of selected stress-responsive genes at tissue and cell type-specific levels, (ii) discover novel motifs and construct stress-responsive synthetic promoters, and (iii) use these promoters to drive the expression of genes shown to confer abiotic stress tolerance in a variety of crops and develop abiotic stress-tolerant poplars in a coordinated fashion.

09 BIOMASS FUELS↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Dynamic nitrogen fixation in an aerobic endophyte of Populus

Biological nitrogen fixation by microbial diazotrophs can contribute significantly to nitrogen availability in non-nodulating plant species. In this study of molecular mechanisms and gene expression relating to biological nitrogen fixation, the aerobic nitrogen-fixing endophyte Burkholderia vietnamiensis, strain WPB, isolated from Populus trichocarpa served as a model for endophyte–poplar interactions. Nitrogen-fixing activity was observed to be dynamic on nitrogen-free medium with a subset of colonies growing to form robust, raised globular like structures. Secondary ion mass spectrometry (NanoSIMS) confirmed that N-fixation was uneven within the population. A fluorescent transcriptional reporter (GFP) revealed that the nitrogenase subunit nifH is not uniformly expressed across genetically identical colonies of WPB and that only ~11% of the population was actively expressing the nifH gene. Higher nifH gene expression was observed in clustered cells through monitoring individual bacterial cells using single-molecule fluorescence in situ hybridization. Through 15 N 2 enrichment, we identified key nitrogenous metabolites and proteins synthesized by WPB and employed targeted metabolomics in active and inactive populations. We cocultivated WPB Pnif-GFP with poplar within a RhizoChip, a synthetic soil habitat, which enabled direct imaging of microbial nifH expression within root epidermal cells. We observed that nifH expression is localized to the root elongation zone where the strain forms a unique physical interaction with the root cells. This work employed comprehensive experimentation to identify novel mechanisms regulating both biological nitrogen fixation and beneficial plant–endophyte interactions.

15 N-tracking metabolomics↗